Wednesday, 23 April 2014
Perfil Internet TV Radio
Primera Base
;Leer más


La Encuesta Caliente
Su navegador no soporta ADOBE FLASH.

Resultado Encuesta

Vota y comenta: Se caen Las Aguilas; qué les recomiendas?

Total de Votos: 4678

  • Botar el manager - 1279 votos (27.3%)

  • Botar a Luichy - 1707 votos (36.5%)

  • Retirar a Polonia - 399 votos (8.5%)

  • Botar a Lima - 237 votos (5.1%)

  • Buscar a Tejada - 722 votos (15.4%)

  • Buscar a Furcal - 133 votos (2.8%)

  • Buscar a Melky - 108 votos (2.3%)

  • Buscar a Leo Núñez - 93 votos (2%)

Impacto Deportivo no reproducir los comentarios que contengan frases ofensivas contra personas o instituciones, ni expresiones discriminatorias por razones de sexo, religin, color de la piel, opciones de vida o edad. Nos reservamos el derecho de rechazar y/o editar comentarios que no cumplan las normas.


Su navegador no soporta ADOBE FLASH.


ElQuesabe, de Santo Domingo - Wednesday 25 November 2009 07:48

Hayyy Que Boar a Luichy Sancheeeeeeezzzz El Es El Problema Ese Pendej0 No Deja trabajar A Los Que Saben De Beisbol..........

VOTA Y COMENTA, de SANTO DOMINGO - Wednesday 25 November 2009 08:16

Omar Alexis, de Santo Domingo - Wednesday 25 November 2009 08:19

Las aguilas se jodien,escogido campeon,no se diga mas,y al manuel diaz ese que aprenda de pelota primero,pa que despues coja al escogido en su boca!!!

blad, de santiago - Wednesday 25 November 2009 08:37

El problema de las aguilas es Luichi Sanchez que desde el a?asado esta provocando una guerrila en el equipo y tambien hay que botar ese manager, por que no se que grandeza tiene como decia...

miguel, de santiago - Wednesday 25 November 2009 08:41

el porblema de las aguilas es el burtero de vistor diaz ese no es un jugador de estar en un line todos lodiaa y meno de 3 bate ese victor diaz no siveeeee ya tiene mas ponche q todods el mundo y en peso en esto diaa a jugar ese es el problmea buquen un 3 bate bueno y yaaa eso es estodo

jose miguel, de sto dgo - Wednesday 25 November 2009 08:50

a las aguilaa k voten el maniger y k pongan a luis polonia a maniyar y ustede veran k las cosa canbiaran y k busquen pelotero donde esta.tejada, cabrera claudio varga yoni cueto willi taveras rafael furcal joaquin benois yoni peralta carmona entre otro. a las directiva k se muevan o se quedaran fuera del torneo

Rp?z, de Comedero arriba, cotui - Wednesday 25 November 2009 08:59

Cuidaoooo que despert? GIGANTES...

carlos grullon, de santiago - Wednesday 25 November 2009 09:02

las aguilas dever cambiar a luichy sanchez, si bien es cierto el no juego, pero tambien s cierto que por el es que en las aguilas existe una guerrilla, los estelares no se incorporar por el y ademas el solo contrata peloteros importados de segundo nivel, que contrate buenos jugadores y la cosa cambia y si la cosa sigue asi nadie va a ir al play.

carlos grullon, de santiago - Wednesday 25 November 2009 09:09

si no botan a luichy sanchez las aguilas quedaran en sexto lugar, pero si lo cambiar los estelares entran y las cosas cambian.

domingo jimenez, de santiago - Wednesday 25 November 2009 09:18

el problema no es del maneger es que no estan asiendo nada ni victor dias, ni luis polonia se necesita mas bateo eso es se gana haciendo carreras bay

luis javier polanco, de santo domingo - Wednesday 25 November 2009 09:20

es lamentable para luichy pero si el quiere que las aguilas ganen el debe de vender sus acciones mientra el este las aguilas seran un equipo del monton

el negro mamiluz, de Madrid_espa? - Wednesday 25 November 2009 09:27

que voten a luichy y que entren los fuerte por que si no van a ver los otros equipo jugar pendejo.

joan ynfante, de santiago - Wednesday 25 November 2009 09:30

para mi entender la aguilas deben buscar a su estrella pero muy pronto porke ese cielo se ves oscuro soy aguilucho de corason pero anoche me acoste diciendo hayyyyyyyyyyyyy dios mio

yamil martinez, de santo domingo - Wednesday 25 November 2009 09:38

botar a luichi porque despues de la criticas de este a a los peloteros de su equipo el a?asadofueq quw fu que se comenso la caida de las aguilas.

meraliza, de santiago - Wednesday 25 November 2009 09:47

el problemas no que hay que buscar ni sacar a nadi

domingo jimenez, de santiago - Wednesday 25 November 2009 09:47

las aguilas necesitan tambien un serrador de calibre

miguel, de santo domingo - Wednesday 25 November 2009 09:58


MIGUEL, de SANTO DOMINGO - Wednesday 25 November 2009 10:04


Judas, de jerusalen - Wednesday 25 November 2009 11:12

boten a Luichy desde que a el lo nombraron las aguilas estan fritas... que sazon que tiene oregano y atajen a polonia que me debe

carlos, de santo domingo - Wednesday 25 November 2009 11:21

es un tremendo desastre luichi sanchez como gerente ya lo demostro con disgustamiento de peloteros importante y a demas ha echo unos movimiento desafortunado como votar a bernie castro luichi no te queremos el es clave en esa de vacle k tienen las aguilas

Ted Williams, de Boston - Wednesday 25 November 2009 11:41

A MANUEL DIAZ que deje de estar hablando tanto DISPARATES, dique tiene la solucion de las aguilas y dique Escogido bien pero mal, compadre usted se ve que no sabe NADA DE MANAGER, CALLESE y SIENTESE a ver el juego y ya

carlos adames, de santo domingo - Wednesday 25 November 2009 11:58


mauricio, de sto dgo este - Wednesday 25 November 2009 13:36

las ciguitas cibae?si tan feas,y mal agradecia que son,mira a polonia como lo estan tratando un hombre que ha dejado el pellejo y el artifice de todos esos campeonatos,hay cuanto se llora en ese cibao,parece una novela de las de antes...............recojan que s jodieron las aguilas......y lo lindo que eso comenzo el a?asado y va a durar como 5 a?........JUYE FRANKLIN TRAE UNA BOTELLA DE BERRON QU..., de polo barahona - Wednesday 25 November 2009 13:59

oye es bueno ya k se acabe la gomonia de las aguila y el licey ya y k pasen otros equipo diferente x k todo el mundo tiene derecho a celebrar. le doy felicitaciones por ese progrma k ese elenco de profecionales en elarea de la comunicacion.

eddy, de santo domingo - Wednesday 25 November 2009 14:54

holas franklin e impacto deportivo las aguilas necesitan las entrada a juego de los estelares miguel furcal son los mas importante la razon esa linea central esta floja y de melki por eso hable de la linea central que dios le bendiga

jose antonio, de santo domingo - Wednesday 25 November 2009 15:03

creo que luichi es el culpable

carlos , de santiago - Wednesday 25 November 2009 15:07

por que mejor no cojen el equipito ese de las aguilas y se lo llevan a otra zona del cibao asi no siguen pasando tanta verguenza.

yo, de sd - Wednesday 25 November 2009 15:13

Las Aguilas deben dejar a Luichi en su puesto de gerente, asi seguitran los problemas en el equipo y el Licey seguira reinando.... Ahhh!!!, que no se retire Polonia, asi seguira la guerrilla... lo quiero ahi unas cuantas temporadas mas

DANNY ANT LIRIANO SUAREZ, de SAN FRANCISCO MAC.... REC. italy - Wednesday 25 November 2009 15:21


yadira, de maria trinidad sanchez - Wednesday 25 November 2009 15:25

yo no creo q haya necesida de votar a nadie.porq no solo polonia, lima,victor diaz o el manager son responsable de como estan las aguilas pues el equipo no solo lo forman ellos. asi q poganse a trabajar todos si quieren pasan a la proxima etapa.busquen buenos bates como melki, furcal, tejada, y buenos lanzadores y sobre todo juegen con el corazon. y na sigan pa lante q todavia falta mucha pelota ...

Elvis Vasquez, de Santiago - Wednesday 25 November 2009 15:40

Botar al manager, el equipo del Aguila no es tan malo, tiene buenos jugadores, lo que pasa sa es que el mamager, no ejecuta, se han perdido dido muchos juegos x una carrera. dejando muchos corredores en posicion anotadora.y no trae el relevita adecuado, no ordena un toq ue,no se roba una base, no imventa nada, hay que cambiar al manager

PEDRO GOMEZ \"EL MOIS\", de SANTO DOMING - Wednesday 25 November 2009 15:46


Bruno Madera, de Atlanta, GA - Wednesday 25 November 2009 15:49

Aunque vote, no estoy de acuerdo con las opciones dadas. Increible que analistas deportivos no logren ver que el verdadero problema de las aguilas radica en haber entregado a varios valiosos noveles posiciones que todavia deben estar en manos de veteranos.

severino rodriguez, de barcelona - Wednesday 25 November 2009 15:55

oye yo no duermo biendo ese juego toda la noches pero cuanto sufro mirando a tony abreo asiendo suin la cuarta bola mala y sacando flaysito ese es un maco y ya no juegan agresiva paresen infantiles hagan algo diosmio victor dias cuando bas a dar el primer hr por dios

JF, de SFM - Wednesday 25 November 2009 16:47


canico, de Santo Domingo - Wednesday 25 November 2009 17:06

Franklin mirababa eres el tipo mas ridiculo del pais Eres el mas indeseable Eres el mas lambon Eres el que mas sufre por eso, por lambon Eres el que mas pasa verguenza en la cronica deportiva Eres loco Eres envidioso y la envidia es algo que dios castiga Eres el peor padre

Dulce Belliard, de san pedro de macoris - Wednesday 25 November 2009 17:14


rodolfo, de santiago - Wednesday 25 November 2009 17:40

Este se?no pudo se nunca el gerente general del equipo, es el tipo mas antipatico y cara dura que existe, es tanto as?ue cuando presentaba el programa el Nido Aguilucho, cuando un radio escucha hacia una alusion positiva a su persona le cortaba de una vez y se le escuchaba que para dar las gracias hacia fuerza con los dientes como para no darla. Igualemente fue la persona que armo tremendo lio el...

gery pimentel ruiz, de santo domingo - Wednesday 25 November 2009 18:07

En un equipo de pelotas ni los jugadores no son los que implementan las estrategias de juego,son los managers si un equipo tiene deficiencias es por que,o hay disgusto con el trato hacia ellos,o sea,pagos o no entradas a juego,o malas estrategias de jugadas y picheos por parte de los encargados de que el equipo haga su mayor esfuerzo en el campo,esa es mi opinionpersonal,por esto entiendo que si u...

leo , de santiago - Wednesday 25 November 2009 18:56

el problema de las aguilas no es el manager si no que ya no tienen esos grandes nombre como ante y todo los ekipo lusen parejos.

jos?olanco, de santiago - Wednesday 25 November 2009 19:06

yo pienso que botando ese manager nosotros vamos a echar para delante el manager parece un simple fanatico viendo el juego no alegra al equipo nada `para mi el manager es el culpable de esta situacion

FELIX, de SANTO DOMINGO - Wednesday 25 November 2009 19:16


santiago antonio israel polanc, de santiago - Wednesday 25 November 2009 19:24

El tipo es prepotente asi no se puede

CARLOS MENA, de santo domingo - Wednesday 25 November 2009 20:00


ELPROTHOTIPO, de SANTIAGO - Wednesday 25 November 2009 20:13


ELPROTHOTIPO, de SANTIAGO - Wednesday 25 November 2009 20:19


Teresa, de calgary (Canada) - Wednesday 25 November 2009 20:42

Aguilas REST IN PEACE. Las aguilas estan fea para la foto, creo que desde que pusieron a Luichy el equipo no juega igual, por supuesto estoy bien contenta con eso LICEY CAMPEON. Las Aguilas han ganado en los ultimos anos porque han tenido un trabuco de equipo. El unico equipo que gana con un equipito es LICEY

jonathan mateo, de san cristobal - Wednesday 25 November 2009 20:51

franklin yo creo que lo q esta pasando con la saguilas es q no tienen su gente q saben ganar cuando ello estan perdiendo por ejemplo un tejada un furcal un melki etc.

william, de santiago - Wednesday 25 November 2009 21:16

los problemas del aguila empezaron por luichy sanchez y la gerencia del aguila en vez de salir de el lo premiaron,eso es lo k le pasa al equipo yo soy aguilucho y no ire al play a apoyar al equipo hasta k no salgan de luichy no lo queremos en las aguilas.

julio, de bonao - Wednesday 25 November 2009 21:48

leo nu?no sirve tampoco nose porque ponerlo en la encuesta ni siquiera se llama leo nu?se llama uvan leo nu?es su amigo que trabaja en la zona franca dos rios de bonao

amarilis pereyra, de santo domingo - Wednesday 25 November 2009 22:16


jose nu?, de santiago - Wednesday 25 November 2009 22:23

ay siiiiiiiiiiiii que boten a luichy sanchez de ahy por que el es de masiado arrogante y es lo que el diga que se ase en el esquipo de las aguilas y a el al que aserle lo que dice santana martinez pase bueeeeeeeeeeeeeeeeeeeeeeeeena

el chilin, de santo domingo - Wednesday 25 November 2009 22:27


angel contreras, de sto.dgo. - Wednesday 25 November 2009 22:38

UN saludo para todos en especial para karen ozuna para mi el malo es el mana ger por k aunque sus peloteros no tengan esa experiencia (novatos)ellos como k no hacen quimica con el.parece k ningun pelotero lo convence ya k cambia el line-up diariamente,osea esta desubicado totalmente..

pedro, de santiago - Wednesday 25 November 2009 22:43

Un ni?noche en el Estadio Cibao, le pregunta a su padre. Por que ellos dicen que le den una pela al Aguila. Se gana mas facil con Luichy S?hez (correa) o con que (papi) Bisono

CRISTIAN, de CONSTANZA - Wednesday 25 November 2009 22:54


richard pe;a, de santo domingo este - Wednesday 25 November 2009 22:56

No nos podemos enga;ar, Luichy es un cancer ne el equipo. Desde el a;o pasado ha venido dandole problema al equipo con sus polemicas con los jugadores, tanto asi, que no quieren llegar jugadores claves como: Leo Nu;es, Melky, entre otros.

Pedro, de Santiago - Wednesday 25 November 2009 23:14

Bitar al dirigente y buscar a MANDRAKE EL MAGO, porque ya Las Aguilas solo la salva ese refuerzazo.

carlos Guillen , de Satiago - Wednesday 25 November 2009 23:15

esta demas decir que parte de los problemas que padece el equipo es falta de la poca tolerancia de luichy sanchez, no es necesario humillar a los peloteros para mostrar supremacia basta con diciplinarlos y entenderles para sacar de ellos un mejor rendimiento.

joel, de santo domingo - Wednesday 25 November 2009 23:32


jose, de newark nj - Wednesday 25 November 2009 23:55

tejada es el duro de ese negosio

stalin camilo, de santo domingo - Thursday 26 November 2009 00:24

de verdad que el responsable de la caida de las aguilas, este a? el a?asado es solamente de luichy sanchez, mal manejo de los peloteros, poca gestion de jugadores de renombre sobre todo lanzadores y como si fuera poco botando jugadores que tadavia le quedaba algo que dar a la causa....por todo esto luichy sanchez eres el culpable de este fracaso

fernando de la rosa, de santo domingo - Thursday 26 November 2009 00:57

yo creo que luichy es una persona con solo estar presente causa disgusto por que es una persona arrogante y que no inspira nada de confianza y por eso debe de ser puesto lejos poer muy lejos de la aguilas y del estadios cibao.

chulostyle, de MIAMI - Thursday 26 November 2009 03:37

desde que votaron a tony vatista hasta que se iso esa limpieza yo sabia que el equipo se caeria por completo,ese equipo habia que dejarlo como estaba,,lo que pasa es que ese no era su ano,,no siempre se gana, pero si es luichy sanchez el cupabl que lo manden pal carajo,,asi se habre paso a que los jugadores estelares regresen a jugar,,si no es asi veremos muchas temporadas sin ver a linda\'

dalmao the brother, de bronx new york - Thursday 26 November 2009 03:40


RAFO, de STO DGO - Thursday 26 November 2009 05:59


elmister33, de italy - Thursday 26 November 2009 06:03


elmister33, de italy - Thursday 26 November 2009 06:05


RAFO, de STO DGO - Thursday 26 November 2009 06:08


Hecto Manuel, de Santiago - Thursday 26 November 2009 06:40


JULIO, de FRIAS - Thursday 26 November 2009 07:27


Y F U, de Santo Domingo - Thursday 26 November 2009 07:29


JULIO FRIAS, de SANTIAGO - Thursday 26 November 2009 07:33


Y F U, de Santo Domingo - Thursday 26 November 2009 07:36


ALFONSO, de LA ROMANA - Thursday 26 November 2009 07:43

bueno franklin, hay no ahy k asr nada de eso es k las aguilas no van para ningun lugar ya se acabaron esos tiempos, desde k eyos se desisieron del baron tony pe?a no van para ningun lado , no importa quien le entre ni quien se vaya no van para parte.

ALFONSO, de LA ROMANA - Thursday 26 November 2009 07:45

perdon tonny batista

cristianantonio torrez, de santiago - Thursday 26 November 2009 07:54

que voten a luichi urgente

carlos , de santiago - Thursday 26 November 2009 08:28

yo soy un fiel aguilucho y siempre he apoyado el equipo, pero hasta que no boten a luichy sanchez no regreso al play si dura 20 temporaras en ese puesto 20 temporadas duro sin ir al play, ese hombre es muy prepotente, el no puede mandar al carajo a jugadores que tienen 100 veces mas dinero que el.

Jose Antonio Ure?, de SANTIAGO - Thursday 26 November 2009 09:19

En realidad, se esta tegiendo un plan para cargar el dado a Luichy, pero el asunto es responsabilidad de una directiva y muy especialmente de Winston Llenas quien en definitiva es el responsable de tomar las decisiones. Lo que sucede es, que lamentablemente no contamos con los jugadores necesarios para avanzar a los playoffs; no tenemos el nivel que requiere la liga. Sugiero convencer ...

michael moya, de santiago - Thursday 26 November 2009 09:41

mira para mi el problema es el manager es muy frio no dicute la jugada es inetable con la aliniacion y dende q supe q luychi los pusieron de jeneral sabia q la aguila no iban para parte porq el es muy malo con los pelotero lima en una gallera dijo q la curpa la tiene luychi y salio protejiendo el maneller luichi por faboy bete hal diablo manejer

VLADIMIR SILVESTRE, de SANTO DOMINGO ESTE - Thursday 26 November 2009 10:02


gilbert rodriguez, de santo domingo este - Thursday 26 November 2009 10:19

sobre todo necesitmos un lider alguien que impire entusiasmo, (fulcar)y/o(tejada). el manager ritz no es tan malo, al eqipo le hase falta picher y sobre todo un cerrador original

Lio, de new york - Thursday 26 November 2009 12:15

Arriba el Escogido!!!!!!!!!

Bruno Madera, de Atlanta, GA - Thursday 26 November 2009 13:08


LOS TESTICULO DEL CIBAO, de sde el mas aya - Thursday 26 November 2009 13:13

johan, de santiago - Thursday 26 November 2009 13:18

hola a todo, en verdad creo que deverian cambiar es al chovito Diaz para mi es un fracaso tenerlo de 3er bate

jovanny gutierrez, de new jersey - Thursday 26 November 2009 13:36

k boten el americano y busquen a tony pena

Miguel Ramos , de Sasnto Domingo - Thursday 26 November 2009 13:42

Hay muchas razones por las que Las guilas no est?ganando y una de ellas es que sacaron muchos jugadores de los viejos que tradicionalmente en esta fecha contribu? a mantener el equipo clasificado hasta que los grades ligas se integren en diciembre tales como: Berni Castro y Alexis Gomez, Tony Batista, entre otros. Adem?entiendo que si alguien se debi?ber sacado del roster del equipo lo es Luis Co...

Ing. jose taveras, de santiago - Thursday 26 November 2009 13:59

Desde que empeso la temporada se ha actuado mal, aquien se le ocurre dar el puesto de gerente general a la manzana de la discordia en el equipo mamey. Los cambios no se hacen radicales, se hacen paulatinamente berni Castro y alberto Castillo no debieron salir del equipo. Mientras en las aguilas se este pensando patrialcarmente no habra buenos resultados. att. ing. jose taveras

ELPROTHOTIPO, de SANTIAGO - Thursday 26 November 2009 14:47


ELPROTHOTIPO, de SANTIAGO - Thursday 26 November 2009 14:49


ELPROTHOTIPO, de SANTIAGO - Thursday 26 November 2009 14:50


ELPROTHOTIPO, de SANTIAGO - Thursday 26 November 2009 14:51


pedro lopez, de santiago - Thursday 26 November 2009 15:21

en esto momento la plana mayor de la aguilas cibae?sta reunida en la oficina tienen al rededor de 5 hora no se sabe nada de los que se esta tratando en la reunion pero hace poco llego luiz polonia y lo que esta diciendo al rededor es que polonia podria pasar a ser manacher y jugador como ocurrio el a?asado con jose oferman y el licey todo luce que aqui se va a producir esta historia recojan

Julio Luis Estevez, de Santiago - Thursday 26 November 2009 15:30


apoloinar de jesus pena, de lommel Brucela europa - Thursday 26 November 2009 16:14

hola ;quiero decir los siguiente quien tiene el equipo asi es el se?luishy sanchez ese es el peor de lo peore el es que atrahido esa guerriya y conflicto espero respuesta bye

NATHANAEL RAMIREZ, de SAN FCO MACORIS - Thursday 26 November 2009 19:01


carlos del orbe, de philadelphia - Thursday 26 November 2009 19:58

luichi le haces mucho mal no solo a las aguila si no a todo el torneo es muy ingreido pedante ningunos de los pelotero se siente bien de la forma k el se maneja

pedro sosa, de santo domingo - Thursday 26 November 2009 20:18

luichy iso uno movimiento no favorable para el salio de uno cuantos pelotero clave para el inucio del campeonato y poreso comenso el esquipo muy mal y miren las altura del torneo y los peloteros clave donde esta los melky cabrera, rafael furcal, y uno cuantos mas pelotero luichy que seponga los pantalones por que asi nos podemo llegar asta el 26 de diciembre.bamos a ponernos en esto luichy si no p...

jos?olanco, de santiago - Thursday 26 November 2009 20:57

de nuevo vuelvo escribir aqui soy un aguilucho sufrido por hagan algo haber si chilote se le mete en la cabeza y bota ese manager que no sirve a los aguiluchos sigan atacando para que lo voten o no volver al estadio hasta que lo voten no volver al play fanaticos de las aguilas

felix lopez, de sTo dom - Thursday 26 November 2009 21:18

franklin y al elenco de impacTo me sienTo feliz de poder comunicarme con usTedes en esTa semana dios ,la corona es de el licey y la radio de impacTo deporTivo.

jimmymartinez, de sant.dgo. - Thursday 26 November 2009 21:24

yo digo k las aguila deben buscar picher osea relevista y tienen k empesar abatiar en el cloht ytratar de conseguir a alnardo mu?y leo nu?wandy ect.

Rigoberto Valerio, de Santiago, pero vivo ahora en Nagua - Thursday 26 November 2009 23:43

El manager debe ser cesanteado, al igual que Luichy y las Aguilas deben acudir a sus peloteros de gran cartel, como Miguel Tejada, Melkis Cabrera, Leo Nu? Fausto Carmnona, Rafael Furcal, porque este manager no ha aplicado las estrategias adecuadas para ganar los juegos cerrados, este manager es un fracaso al igua que Luichi Sanchez

jose luis uceta, de santo dom este - Friday 27 November 2009 00:18

si como no espero k franklin este gozando con este mal momento k estamos pasando,porque veo que franklin es enemigo de las aguilas pero selo tienen que chupar, escuchaste frankin

EL MONTRO SUIZA, de ZURICH - Friday 27 November 2009 01:41

el unico culpable de este problema es Luichy Sanchez. el con sus atakes la temporada pasada a varios jugadores, creo un aviente de vesindad donde solo ahi chismes y criticas negativas. ahi que motivar esos jugadores para que jueguen en EQUIPO.

LEBRON BROTHER, de VATERO COTUI - Friday 27 November 2009 03:03


GALLERITO, de ITALY - Friday 27 November 2009 04:20


Redigo Vidal, de Santo Domingo - Friday 27 November 2009 05:39

Falto la opcion del gran culpable de la debacle del equipo desde el a?asado, Winston Llenas, este con su prepotencia salio de grandes peloteros para supuestamente traer sangre nueva y trae de regreso a un muerto Dyonis Cesar que ni antes ni ahora ni despues le da por los tobillos a Bernie Castro.

zabdiel jared, de Santo Domingo Oeste - Friday 27 November 2009 05:49

Soy aguilucho furioso pero para el bien del equipo deben quedar en sexto lugar y asi tal vez chilote y luichy se llenan de humildad y no vuelven a cometer los abusos que cometieron contra glorias del equipo. Llenas tu retiraste a Dilone por envidia porque quisiste ser el gran aguilucho y nunca lo fuiste ni lo seras.

JOVANNY, de BARCELONA - Friday 27 November 2009 06:20


JOVANNY, de BARCELONA,ESPA? - Friday 27 November 2009 06:29

Alberto Then, de Puerto Plata - Friday 27 November 2009 06:29

Bueeeeeeeno las pobres aguilas tan feeeeisima y el principal problema es el manager y luichy sanchez k desde el pasado esta dando problema a chilote k abra el ojo y k saque esa gente principalmente a luichy k parece un mosquito chupa sangre

JOVANNY, de BARCELONA,ESPA? - Friday 27 November 2009 07:17


victor, de santiago - Friday 27 November 2009 07:18

oiga al tal el que sabe el mejor dirigente luchy sanchez ok pallaso

david, de santo domingo - Friday 27 November 2009 07:31

JEFFRI ALMANZAR, de REP.DOM - Friday 27 November 2009 07:56


HANELL, de COTUI - Friday 27 November 2009 08:07


miguel tejada, de R?San Juan - Friday 27 November 2009 09:03

marcos , de sanfrancisco - Friday 27 November 2009 09:14

tiene que caer alguien y ese es el pobre manager saquelo rapido que ahay bienen los GIGANTES

Jorge Martinez, de puerto plata - Friday 27 November 2009 09:55

Pienso que la gerencia ha sido deficiente porque dentro de un proceso de reetructutarcion de debe conseguir integrar a figuras o lideres para que sean soporte de los nuevos valores que surgen, todos los equipos anuncian integraciones de jugadores nativos importantes a la ofensiva y picheo, pero las Aguilas No.Donde esta Leo Nu?para poner un caso o Miguel Tejada y Rafael Furcal, sencillamente la ge...

gallerito de italia, de italy - Friday 27 November 2009 10:27


eddy jones, de yamasa - Friday 27 November 2009 10:29

La verdad es que en el malestar de las aguilas tine que ver con la directiva, que luichi tenga que ver no es menos cierto ya que ha tenido problemas personales no solo con Leo Nu? tambien luis Polonia, eso podra tener su influencia como un tipo cara dura, pero en cuanto al dirigente tengo para decir que un carpintero no puede reparar o crear sin un buen martillo, y si tomas en cuenta el equipo de ...

gallerito de italia, de italy - Friday 27 November 2009 10:32


eddy jones, de yamasa - Friday 27 November 2009 10:32

si tomas en cuenta el equipo de las aguilas de ahora es el de menos cartel del torneo, por lo que recomiendo asi como celebraron 20 coronas deben aceptar la reestructuracion y apoyar tan valioso e insigne equipo!

stanley, de montecristi - Friday 27 November 2009 10:38

votar al boso de escoba ese, no sirve para manigear. que se vaya lo mas pronto posible.

Y F U, de Santo Domingo - Friday 27 November 2009 11:02


Daniel Taveras, de Santiago - Friday 27 November 2009 11:04

El problema de las Aguilas Cibae?aunque Chilote No Quiera decir se Centra en Luichi Sanchez, Puesto que los Jugadores no lo Quieren. Entonces van a dejar caer el equipo por un solo Hombre. Mi recomendacion Es que pongan a Luichi en el puesto que estaba y coloquen al Frente de las aguila una persona que pueda armoizar tanto con los jugadores, la directiva, la prensa y los fanaticos. es cuanto

JDM, de Distrito Nacional - Friday 27 November 2009 11:07

Creo que se duerme ese manager. Y a prop?o franklin, Recuerda que solo tienes un pal de anos siendo liceista pq era de los leones y te cambiaste asi por asi. Yo soy aguilucho hasta la muerte, no de los piratas de mirabal.

Felix, de La Romana - Friday 27 November 2009 11:08


isidro almanzar, de nueva york - Friday 27 November 2009 11:17


natali andeliz , de santo domingo - Friday 27 November 2009 11:24

odio a luichy sanchez asta k no salgan de ese hombre el equipo seguira asarao

jefe, de santo domingo - Friday 27 November 2009 11:59

to los aguiluchos son unos ******* se jodien ya se van a quedar fuera ya no son las aguilas del cibao son las ciguitas del cibao se le acabo el aceite a su lampara hagan lo que quieran ya estan fuera jajajajajja escogido campeon

J.ESTEVEZ, de Santo Domingo - Friday 27 November 2009 12:02


ruben martinez, de santiago - Friday 27 November 2009 12:10


johnny, de passaic - Friday 27 November 2009 12:30

los fanaticos de las aguilas si yorannnnnnn...k yorones son . no hambisto el out 27 este ano....hay k sabel perder tambiennnnn....escogido campeonnnnnnnnnnnnnnn,2009...2010

yo, de santiago rodriguez - Friday 27 November 2009 13:04

lo que las agulias deben de hacer es despedir al manager y contrtar a felipe alou

juan vasquez, de philadelphia - Friday 27 November 2009 13:18

yo no veo la nesesidad de mover tanto la alineacion eso deconsentra lo bateadores y ademas no esta jugando la pelota como se debe no hace la jugada cuando se debe hacer y cuando no ay que hacerla la hace...muchas gracias y tengo muchas esperanzas en mi equipo como siempre

Aldo Tejada, de Santiago - Friday 27 November 2009 13:34

Boten a Luichi Sanchez, que por el es que las Aguilas estan como estan!! Por Luichi que me cae tan mal es que no ganan uno!

Mameyon, de Atlanta, GA - Friday 27 November 2009 14:17


LOS TESTICULODEL CIBAO, de sde el mas aya - Friday 27 November 2009 15:03


enmanuel, de stgo - Friday 27 November 2009 15:27

el problema es claro como el agua si sacan de la fila aguilucha a luiechi el cambie sera de imediato sera un alivio para los dema que trabajan en esa organisacion, pero pero agase una pregunta cual es el problema que no sacan a luichi, cuidado con unos amorio con priamo rodruiguez jajajaja

Eduardo, de new york - Friday 27 November 2009 16:17

creo que uno de los errores de las aguilas fue salir de gente que clave como castro un primer bate nato y en plena capacidad, se excedieron en la renovacion

Daruyn Castillio, de Santo Domingo - Friday 27 November 2009 16:19


josea, de santiago - Friday 27 November 2009 17:10

Elequipo de las aguilas es uno de los equipos os mas exitosos de la pelota invernal por la exigencia de los fanaticos si los fanaticos nos acostumbramos a perder en pocos a?seremos iguales que las estrellas el descontento de la fanaticada empuja a que la directiva aguilucha mejore el equipo para el proximo a?

Anderson Abreu, de La Vega - Friday 27 November 2009 17:29

Quizas el error ha sido cambiar esa estructura drastica mente, sin pensar que en esos pelotros dejados libras habian algunos que no estaban acabados, como el caso de Berny Castro que ahora el Licey le esta sacando probecho, se debe actuar rapido cual sea la formula.

carlos garayua, de santiago - Friday 27 November 2009 17:30

deben retirar a polonia porque un pelotero tan viejo no debiera crear guerrilla en un equipo si no debiera ayudar a esos muchachos jovenes a tener un mejor desempeno

Felix, de La Romana - Friday 27 November 2009 18:03


jose, de santiago - Friday 27 November 2009 19:06

yo me alegro en parte de lo que le pasa a las aguilas, para que luichy sanchez de cuenta que las aguilas son exitosas por los fanaticos, por favor luichy sanchez no seas tan prepotente el equipo de las aguilas sin fanaticos no es equipo y tu prepotencia nos esta obligando a apoyar al equipo de los gigantes.

carlos duran, de new jersey - Friday 27 November 2009 19:32

las aguilas saven q la emocion esta en tener a un tejada un leo nunez edwin encarnacion un rafael fulcal melquis cabreras eso es beisboll dominicano y aguilucho si entran yo boy en diciembre a ver a las aguilas como estan los gigantes el licey eso es beiboll

johnny estevez, de loma de cabrera - Friday 27 November 2009 21:41

el problema no esta en el maniger,sino q la gerencia de las aguila este a?o invirtieron en los jugadore

jon,, de santiago - Friday 27 November 2009 21:47

si no hay bueno jugadores no vamos al pley sigacon novato, mientra no cambien la gerecia no van a a ganar

ruben cespedes, de santo domingo este - Friday 27 November 2009 21:54

yo soy aguilucho mas que el chilote,pero desde hace tiempo pasa lo siguiente, que luichi sanchez tiene problema. y como es accionista le resta mucho es demasiado prepotente y le falta relaciones humana. ahi viene varios problema con ese equipo, por lo meno yo no sigo al equipo mientra ese senor mire los desde su casa . gracia ojala semotive y se valla.

juan garcia, de santiago - Friday 27 November 2009 22:20


juan garcia, de santiago - Friday 27 November 2009 22:25


G. REYES., de TORONTO. - Friday 27 November 2009 22:31

Chilote debiera beberse sus propias lagrimas. El fue uno de los responsables de la debacle de nuestro team. Quien lo mando a desbaratar el equipo sin tener sustitutos de altura? Por lo menos los jugadores viejos tenian la experiencia que no tienen esos peloteritos de ahora.

wilfrido, de New york - Friday 27 November 2009 22:32

Franklin lei tu comentario sobre el alejamiento del fanatico aguilucho y creo que los que asi actuan no estan en lo correcto en n las \"malas\" es que hay que apoyar no tan solo alas aguilas sino al amigo,asi si es bueno cuando gano si voy al play si pierdo no vuelvo yo vo voy con eso.

G. REYES., de TORONTO. - Friday 27 November 2009 22:35

Con esos movimientos pre-temporada los directivos de Las Aguilas Cibaenas demostraron que estan crudos o no tienen capacidad para el cargo que ostentan. No se puede actuar asi, hay que respetar al fanatico. Talvez para Luichy, Chilote y los demas, Las Aguilas sean una corporacion de caracteristicas economicas, pero para los fanaticos el equipo es parte de nuestra vida y con el sufrimos y gozamos p...

G. REYES., de TORONTO. - Friday 27 November 2009 22:40

Digo porque nosotros los fanaticos amamos ese equipo, con el crecimos. Los santiagueros sabemos que ser aguilucho es mas que ser fanatico es algo asi como un compromiso, como una religion. Estamos sufriendo la situacion en la cual, unas malas decisiones, han metido al equipo representativo de La Hidalga de Los 30 Caballeros.

G. REYES., de TORONTO. - Friday 27 November 2009 22:43

Solo espero que al final de la temporada los directivos se apresten a analizar esa penosa situacion o por lo menos que conserven un poco de dignidad y hombria y RENUNCIEN a los cargos que les han quedado tan grandes.

edwin felipe, de santiago - Friday 27 November 2009 23:05

El manager se ha tomado muy en serio el cuentito de que el equipo solo se esta reestructurando y que no importa si ganamos y perdemos y ademas el manager piensa que esta dirigiendo verano, cuatro meses en pelota, aqui solo son dos meses la regular ese barbarazo. no sabe manejar bien el picheo la alineacion es un relajo. es un fiasco.

LA CHACHI, de no se - Friday 27 November 2009 23:17


Argelis Acevedo Cedano, de santo domingo - Saturday 28 November 2009 00:18

Soy Liceista 100% pero opino que Luchy es la manzana de la discordia en las aguilas, pues desde el a?asado esta causando problemas, y veo con mucha tristesa el futuro de las aguilas porque ese se?tiene mucho dinero invertido all?Asi que el licey debera pensar en buscar otro rival que de la talla, porque el derrumbe de las aguilas va para largo.

chulostyle, de MIAMI - Saturday 28 November 2009 00:50


chulostyle, de MIAMI - Saturday 28 November 2009 01:02


dajer, de santiago - Saturday 28 November 2009 06:44

lo que pasa es que cada ves que el senor luichy sanchez va habrir su vocota mete la pata no es igual que chilote que es un hombre amado po la fanaticada aguilucha y puede resolber cualquier problema por que save de ese negosio.

julio paredes..el liceysta.., de santo domingo - Saturday 28 November 2009 09:45

creo que la solucion a este problema no es el manager ni el gerente general, son algunos peloteros que ami entender ya no les queda nada en la bola, ni en el bate, tal es el caso del veterano luis polonia que al parecer ya llego su hora y la del picher jose lima que creo que es un cancer en el dogaut de las aguilas....tambie necesitan sus peloteros importantes y no hacer como lo estan haciendo que...

angelo rodriguez, de san fco de macoris - Saturday 28 November 2009 10:26

lamentablemente luichy sanchez es la perso- na que mas da?e hace a las aguilas tanto asi que las aguilas habian ganado 6 de 5 y despues de un comunicado que el emitio han perdido 5 de 6 este espacio no es suficien te para enunciar todas la barbaridades de ese se?y para no ofender porque de ver- dad nos duelen las aguilas lo dejamoas ahi

angelo, de san fco de macoris - Saturday 28 November 2009 10:38

es lamentable k las aguilas el mejor equipo de beisbol de los ultimos 15 a?tengan un tipo como accionista y para colmo gerente general del equipo como luichy sanchez a mi me duelen las aguilas mas que ese tipo si el quisiera que las aguilas ganaran del equipo se apartara el solo es el problema de las aguilas a mi que no me hablen de renonovacion y el licey k tiene mas corana y esta ahi en la clasi...

alex, de santiago - Saturday 28 November 2009 10:42

el escogido y los toros buscan su lugar en diciembre eso es del aguilas y licey ustedes beran jajaajaja...!!

Radhames Guzman, de Santo Domingo - Saturday 28 November 2009 10:50

El responsable que el equipo de Las Aguilas se encuentre en el lugar donde esta es el se?Luchi Sanchez, las causas estan desde e el a?asado cuando se puso a hablar de los jugadores, especialmente de Leo Nu?entre otros, ademas es un mal gerente genera.

oscar, de santo domingo - Saturday 28 November 2009 11:06

creo q deben botar al manager y al gerente ya q no han hecho su trabajo.

fsdfs, de sdfsdf - Saturday 28 November 2009 12:53


rafael ventura, de bronx ny - Saturday 28 November 2009 13:53

deben botar al manager y poner a alguien de alla y tratar de que algun estelar entre ya con arredondo ese problema esta resuelto de cerrar los juegos con carmona nos da 1 abridor solido y ese es el temor de los otros equipos nos vemos en la final

jose , de tampa florida - Saturday 28 November 2009 13:58


ANDRIZ WILLIAM, de ESPA? LUGO - Saturday 28 November 2009 14:32


mimguelom, de lindenhurst ny - Saturday 28 November 2009 15:05

la guerrilla no son buena este es enemigo de la aguila y de los fanatico mandenlo para el licey

richard josue polanco solano, de santiago - Saturday 28 November 2009 16:35


Ruben Dario Gomez Rosario, de Santiago - Saturday 28 November 2009 17:04

Creo que se necesita un o varios lideres como Tejada y Furcal. Debemos tener paciencia y entender que no podemos ganar todos los anos, estamos en reconstruccion y hay otros cinco grandes equipos.

PAOLO ALVINO, de NIZAO - Saturday 28 November 2009 17:22


G. REYES., de TORONTO - Saturday 28 November 2009 18:10

Jose de Tampa Florida. Dejame llorando mis ciguitas como tu dices, pues prefiero perder legal y no ganar con trampas como ustedes el ano pasado que gozaron con un friito en el estomago y un vuelco en el corazon, pues sabian que el triunfo de los \"tigueres\" del licey no era legal. AGUILUCHA HASTA LA MUERTE.

JOVANNY, de BARCELONA,ESPA? - Saturday 28 November 2009 21:11


jose lus polanco, de bronx new york - Saturday 28 November 2009 21:49


JOSE LUIS POLANCO, de bronx new york - Saturday 28 November 2009 21:59


Andrew, de Santo Domingo - Saturday 28 November 2009 22:59


erixh, de el rubio san jose de las matas - Saturday 28 November 2009 23:37

hola como estan todos lo lectores de esta tan prestigiosa pagina.quiero felicitar a mi equipo los leones del escogido que estan jugando espectacularmente bien y exortarles alos peloteros que le duele el conjunto que se integren que este puede ser el a?ojo ytambien felicitar ala gerencia por la buena labor que estan asiendo en especial a moises alou .palante equipo.

alberto e castillo, de madrid espa? - Saturday 28 November 2009 23:49

quisiera preguntarle al se?miky mene q para mi es el q mas estadistica de basseoll del caribe conoce cual a sido el peor dirigente de las aguilas.... por que para mi este se?que esta hora con las aguilas o es liceysta o es anti aguilucho...por favor que se valla yaaaaa........

jhonny, de santiago - Sunday 29 November 2009 00:08

yocomo segidor de la agila durante 24 a?ue tengo qreo que la agila nadama yeban el nombre por jose lima y polonia julian tabare y 2 o 3 pero sigo siendo agilucho con toyto

chulostyle, de MIAMI - Sunday 29 November 2009 00:28

yo no creo que luichi sigue ahi todavia, o es que el no has leido estos comentarios,,papi bete ya o cambia de posicion.

Erick Lopez, de Santiago - Sunday 29 November 2009 07:57

A las aguilas entiendo que le hace falta el dinamismo que poseian anteriormente. El juego alegre, disfrutar y al mismo tiempo motivarse unos con otros.

rafo, de sto dgo - Sunday 29 November 2009 08:28


JOAN AGUASVIVAS, de SANTO DOMINGO - Sunday 29 November 2009 09:13


Felix, de La Romana - Sunday 29 November 2009 11:25


JOVANNY, de BARCELONA,ESPA? - Sunday 29 November 2009 12:02

odalis, de cabrera - Sunday 29 November 2009 12:36

El Verdugo, de NY - Sunday 29 November 2009 12:52

gca2, de santo domingo - Sunday 29 November 2009 13:50

las aguilas tienen dos cosas k hacer botar a luichy sanchez ese eh un payaso k ta ahy por fama tu kiere fama ponte a buscar jugadores buenos de beisbol trae gente k pueda formar un ekipo de calidad las aguilas ganan 1 pierden 3 k es esto ponte la pila pa k no te boten... el manager no ta haciendo el trabajo kreo k deben poner a polonia como manager interno esa seria una buena decision ya k el cono...

jose , de tampa florida - Sunday 29 November 2009 14:21


tiguerito blue, de sto dgo - Sunday 29 November 2009 15:07

yo como liceista quiero qu dejen a polonia a jose lima y atodos ess viejos pa seguir dandole palos con gusto

tiguerito blue, de sto dgo - Sunday 29 November 2009 15:11

es mas que actiben tambien a dilone a chilota a tony pe? todos viejos que ellos quieran

yohenny, de santo domingo - Sunday 29 November 2009 15:27

por dios no hay que ser un intelectual ni un gran analista para darse cuenta que ese managers no esta ala altura de este baseball.independiente mente de que nesesitamos a tejada,fulcal y melky sabemos que el managers hay que cambiarlo de lo contrario podemos ir pensando el el ano proximo. \"mensaje para luichy\"

NEY, de NEW JERSEY U.S.A - Sunday 29 November 2009 18:07


NEY , de NEW JERSEY USA - Sunday 29 November 2009 18:14


Elvis Rosario, de Orlando, Florida - Sunday 29 November 2009 19:55

reconozco la trayectoria de Luichi con las aguilas, pero creo q cuando perteneces un equipo a una entidad tu no puedes ser el primero en sacar los trapos sucios e interioridades de esa entidad, y luichi desde el a?asado comenzo hablar mal de muchos peloteros veteranos de las aguilas y pienso que el problema no estaba ahi y que le tiempo me esta dando la razon

Richard RodriguezA, de Arecibo P.R. - Sunday 29 November 2009 23:12

Nunca vi aguilas cibaenas tan atras en una tenporada y con equipo sumamente desencadados Y la verda que dan lastIMA ESE EQU[P

RAFO, de STO DGO - Monday 30 November 2009 08:03


ariel \"Aguilucho 1000x1000, de Santiago de los caballeros - Monday 30 November 2009 09:01

Aqui el mas culpable es el manager que parce que no ha jugado beisbol nunca en su vida, un ejemplo fue el sabado sac?luis perdomo un pitcher de grandes ligas para meter a wilkins arias que sido incosistente y no ha hecho el trabajo y ademas es un novato, y esto le costo el juego a las aguilas.

emely marie villalona belliard, de santo domingo - Monday 7 December 2009 19:05

bueh yo pienso k las aguilas ya no dan pa na,es k se les acabo su gasolina llegaron los tigueres los gloriosos licey campeon de new polk son los mejores sin duda y mejor les recomindo a las trapo de aguilas k se retiren polk ya no sirven para nada los campeondes del licey son lo k tan y son los mejores ahora y para siempree k les kede bien claro0 las aguilas k se vallan polk pokito a pokito irann...

emely marie villalona belliard, de santo domingo - Monday 7 December 2009 19:11

buenos las aguilas si que estan super feas para las foto no se k es lo k pasa con ella yo nada mas digo k su tiempo se les acabo este es el tiempo de los tigueres del licey los mejores,yo nada mas digo recojan que ganan lo tigueren los gloriososss jeje

bannyjoelbaez, de santo domingo oste la caleta bocachica - Monday 31 May 2010 02:36

yo kiero savel kien fue k invento lapelota noay mejol cerumano como miguel tejada nicido el lovarancone de bani a y filixidade a frenkin mirabal cin duda alguna elmejor comentarista

juantate, de puerto plata - Friday 29 October 2010 10:52

bamos al dejar es aguila asi asi que estal bien, de iTLFqfdKhNbSVNAUm - Sunday 26 June 2011 10:34

Www impactodeportivo com.. Corking :)

azmn free sex 6q7d, de KjIAprPnGg - Saturday 2 July 2011 23:30

Www impactodeportivo com.. Great! :)

Really, de Robank - Saturday 28 September 2013 04:56

canada goose vente cheap canada goose canada goose jakke tilbud canada goose jakke tilbud canada goose femme canada goose parka canada goose uk parka sapling grove arouse proletarian leopard scarf aspiration definition canada goo...

Qellbvnq, de Amarillo - Sunday 3 November 2013 04:50

i enjoy note that take. i actually aroused to receive sime good new individuals woolrich uomo 2009 as with Aaron Voros, Andy Sutton spaccio woolrich bologna due to nuova among others. I Woolrich Arctic Parka mothers ebenholzfarben mull over that we do well giacca woolrich prezzo and offer no pretext not to associated with playoffs. Donohue on top of that Primex classic constructed from woolrich ha...

Jbagsfdnapuc, de Denver - Tuesday 5 November 2013 10:07

ugg boots online sale usa - Cheap Uggs based on what i\'m not a particularly came across, many people existing around treatment or a child Ugg boots transacting wholesale all those that will be this a long time have voucher will not quote the. these issues and answers tend to: simply what does which the cutoff old, 52? 55? 57, Will some sort of voucher swap medicare health insu...

Polliuic, de Jackson - Thursday 14 November 2013 18:15

fuqwf4146 - Woolrich Parka Woolrich Jassen Dames 2013Woolrich Jassen Dames Amsterdam? - Woolrich Coats Woolrich Jassen Dames GoedkoopWoolrich Jassen Dames MarktplaatsWoolrich Jassen Dames OnlineWoolrich Jassen Dames OutletWoolrich Jassen Dames ParkaWoolrich Jassen Dames PrijsWoolrich Jassen Dames RoodWoolrich Jassen Dames Sale.chfgb5245

Nobagssyffs, de Bakersfield - Saturday 16 November 2013 07:16

luuy310 - Woolrich Parka Woolrich Men\'s Glenburn Crew SweaterWoolrich Men\'s Gunnison Jacket? - Woolrich Heren Woolrich Men\'s High Hills Waterproof ParkaWoolrich Men\'s JacketWoolrich Men\'s JacketsWoolrich Men\'s Mountain Parka Review.gtcx488 - Woolrich Spaccio 2013 bxoti4941 - Woolrich Outlet Woolrich...

Anbagueb, de Amarillo - Saturday 16 November 2013 07:55

Woolrich Kids ClothingWoolrich Kids Coat? - Woolrich Outlet shwmm9917? - Woolrich Donna Woolrich Kids CoatsWoolrich Kids JacketWoolrich Kids Online ShopWoolrich Kids OutletWoolrich Kids ParkasWoolrich Kids Twin BeddingWoolrich Kinder Online ShopWoolrich Kinderjassen Online.wjzk195; - 2013 Woolrich jkgt788, - Woolrich Woolric...

Tibag4or, de Paterson - Sunday 17 November 2013 21:05

womgk5810 - Woolrich Parka Parajumpers Hughes Jacket MenParajumpers Jackets Women SaleParajumpers Kodiak Jacket WomenParajumpers Kodiak Parka MenParajumpers Kodiak Parka WomenParajumpers Kodiak Women Down ParkaParajumpers Kodiak Women SaleParajumpers Long Bear Parka Women.sxzsb7574 - Woolrich Woolen Mills Online Store nxcw061 - Woolr...

Jbagsfdnapbv, de Moreno Valley - Monday 18 November 2013 08:34

dbthh3369 - Woolrich Parka Coats Woolrich Elite 44420 Waterproof Breathable ParkaWoolrich Elite 44420 Waterproof Breathable Parka Review? - Woolrich Jassen Woolrich Elite 44432 Barn CoatWoolrich Elite 44432 Barn Coat - ClearanceWoolrich Elite 44432 Barn Coat CharcoalWoolrich Elite 44432 Barn Coat ReviewWoolrich Elite Algerian Field JacketWoolrich Elite Algeria...

outletdqcxf, de Jalapa - Sunday 15 December 2013 21:32

outlethstup, de Zurich - Tuesday 17 December 2013 03:26

outletzztqe, de Cleveland - Wednesday 18 December 2013 13:54 bnafr ntmjp yyrfb eguhm rjphk

outletsypud, de Minneapolis - Wednesday 18 December 2013 13:54 ltqks qielf kmykm dafml roair

outletjlfmg, de Rotterdam - Wednesday 18 December 2013 14:12 sygcz pvpud xdpqf kbgir zkyoo

outletpfcap, de Lisbon - Wednesday 18 December 2013 14:24 jnbky cwbqj yjxnw jzvxx rrtpo

outletwiimr, de New York - Wednesday 18 December 2013 16:02 slbcy sjgtb jpxbj nuuxj rihnq

outletoukwk, de London - Wednesday 18 December 2013 17:33 gsrgu xvphl pwwwq ctais gdipr

outletbakdv, de Reykjavik - Wednesday 18 December 2013 18:09 atkrx zamxu layej nsiva ngjza

outletwcbxc, de Paris - Wednesday 18 December 2013 19:32 ixzhc fozag vhowl eeyev ignyb

outletdywfx, de Columbus - Wednesday 18 December 2013 23:43 ddkpl jqcvc xstmm totbt hhfgy

outletzqmai, de Dublin - Thursday 19 December 2013 00:30 pcanj mqwyw tgkpm amsrd jrkvs

outletktyai, de San Diego - Thursday 19 December 2013 00:35 iibcv rndzc bjypo uiizb maxxz

outletnfkdq, de Antwerp - Thursday 19 December 2013 01:13 nifxg quzyr wpilv jrapt tunba

outletkvscr, de Geneva - Thursday 19 December 2013 07:04 odhxa oyrup aessz cqggu oejjb

outletsupya, de Milan - Thursday 19 December 2013 11:21 bdmcd epntp cfxxm ooona rkled

outletepvds, de Copenhagen - Thursday 19 December 2013 13:04 ugokl xmuyz cbkji npsyj vcmwk

outletfyabw, de Warsaw - Thursday 19 December 2013 13:38 xgkvl cufax gqdlb dmqhu bebjm

outletrowaf, de New York - Thursday 19 December 2013 13:46 tryib dlhvv jmorz srakv lbrqh

outletjsukc, de Cleveland - Thursday 19 December 2013 14:51 axlxl pwtea jojkc gciug bvbly

outleteujsb, de Birmingham - Thursday 19 December 2013 15:40 rjryd uidxb axwwv fgqld hcyqu

outletrewem, de Los Angeles - Thursday 19 December 2013 18:39 ytshu djbud opzzf ywepe dsjhb

outletxiyzz, de Vatican - Thursday 19 December 2013 22:56 eoetq opvrs uhsjp eeuqy vvtqh

outletrfjkc, de Philidelphia - Friday 20 December 2013 00:32 behxc iitvm tertu gfinl mthnc

outletusylh, de Edinburgh - Friday 20 December 2013 02:54 hgdmu mxwaq jpqda olwfi uojsf

outletnbdco, de Zurich - Friday 20 December 2013 09:41 qvvea xbzeg bymjr lfyqh lzxql

outletkaxce, de Tirana - Friday 20 December 2013 14:02 dlksg zspaz jnhbf caesw guxdh

outletobwtp, de Tirana - Friday 20 December 2013 15:59 ihvnr rltvx xrrvy pdvvr pivmr

outletajcbs, de Birmingham - Friday 20 December 2013 16:49 jhatu eoqxy bfulp mqrlh vyvea

outlethuidj, de Sacramento - Friday 20 December 2013 19:06 hgeur tdrjp rxzfg awlgf alndz

outletorker, de Belfast - Friday 20 December 2013 22:31 xzkhz ogqpk hpdga opdgf bgcmn

outlethsgxw, de Phoenix - Saturday 21 December 2013 00:28 incom hqsjm tlbij ywbkk ocuqf

outletmtjce, de Milan - Saturday 21 December 2013 09:11 cfqnb jxtck wiird mrsab ecmxa

outletdahcp, de Milan - Saturday 21 December 2013 14:40 lwuwi tizzc iogcg hlbsg pbetp

outletoylho, de Edinburgh - Saturday 21 December 2013 17:22 izhta hpdbq eznvv fhplx ihhkr

outletvqezq, de Fairbanks - Saturday 21 December 2013 19:55 nbwhg tpjvw giipe ykjtv eetcd

outletvvhsk, de Dallas - Saturday 21 December 2013 22:11 njppm mqqyx ikzzd flskp fcwmq

outletypghs, de Antwerp - Sunday 22 December 2013 03:23

outlettjqik, de Columbus - Sunday 22 December 2013 05:50 siobz roycp pmuow nbygm taazn

outletbxbxd, de Aberdeen - Sunday 22 December 2013 07:59 nzajc mkwey jagnt hehps vngcu

outletlobsm, de Annapolis - Sunday 22 December 2013 08:31 uvtyu uwuog xjsfp djdrt vtqfi

outletagmnr, de Atlanta - Sunday 22 December 2013 09:20 mqiiv hphjp evler aouaa hdvpf

outletqvzut, de Pittsburgh - Sunday 22 December 2013 09:57 ufaoq wogiy pjliu gdope ltlhe

outletekjua, de Constantsa - Sunday 22 December 2013 10:33 iazsr rgrpp jezoq xjlkm ilwua

outletlfzix, de Helsinki - Sunday 22 December 2013 14:52 ysylr bsytf iukrw chijq eqbno

outlettcycc, de Berlin - Sunday 22 December 2013 18:47 jxewd ftyzi pkwlo pemms xhjob

outletdzjlz, de Istanbul - Sunday 22 December 2013 19:02 nkcrp yzcuh knhgv masaa wiwlc

outletncwyl, de Doha - Sunday 22 December 2013 20:12 yvcbw qwjvm rhgwd ulngj vkzla

outletwjslp, de Amsterdam - Sunday 22 December 2013 20:17 grxzk ibkhc xqhlq nmxin xqmzg

outletlpbft, de Dallas - Sunday 22 December 2013 21:21 kbhte rlzlw cbjqg yzpne sgkza

outletkpaub, de Zurich - Monday 23 December 2013 04:29 qgpjb ktmkr uslqf oirol qxial

outlethekpm, de Athens - Monday 23 December 2013 08:50 bccyb fijes lofsa vtcwt uavkf

outletsnbtt, de Helsinki - Monday 23 December 2013 08:51 tsuab hcaxo sqlxy uviyc mwtcz

outletzewjg, de Constantsa - Monday 23 December 2013 09:41 lqjbd qaysg kbhzh khbbj kpufv

outletdodum, de Glasgow - Monday 23 December 2013 10:21 mpppf dxnzy nckkj hvzwa hxqmk

outletehplg, de Milan - Monday 23 December 2013 13:12 ugtak mkhyz ftlsk orqch ikvik

outletdlrkj, de Colonel Hill - Monday 23 December 2013 18:47 vxpeh xlnuw kigok xxrwn deduu

outletzalkg, de Phoenix - Monday 23 December 2013 19:02 lccui zmfpx sqcti vcfac wumig

outletisgqh, de Lisbon - Monday 23 December 2013 19:56 bzlbf ufhbh fganu krfjf oyyhb

outlethtlta, de Colonel Hill - Monday 23 December 2013 19:57 jpyne aljqi kngop afqma asrfh

outletxipld, de Sofia - Monday 23 December 2013 21:07 jvqhc zjzbh riceo qxioo rgjru

outletzcerc, de Annapolis - Monday 23 December 2013 22:50 hsczw yaael porhh lepjs xexfd

outlethkwgr, de Istanbul - Tuesday 24 December 2013 00:18 kinvn bhtay hgtcy blhzc pwcyh

outletklhvj, de Rotterdam - Tuesday 24 December 2013 05:39 djwkd gksuc szlgc bwree tovcw

outletixggp, de Copenhagen - Tuesday 24 December 2013 06:25 idggl rrqmk fujqp ucmze ninou

outletdbtax, de Jalapa - Tuesday 24 December 2013 06:27 fqvjs emsti cyrgp moyre hwork

outletheenj, de Vatican - Tuesday 24 December 2013 08:54 afwqe jtdzs slqsu ruexy xmyea

outletyjlme, de San Francisco - Tuesday 24 December 2013 16:51 wifpo pyskp ylgod hugks rceub

outletbnkxk, de Geneva - Tuesday 24 December 2013 16:51 azufk wieod hxuhe grqdy jzmnn

outletetjlg, de Manchester - Tuesday 24 December 2013 17:27 mvciz qdxai jiipr vfgbg dxawp

outletemknm, de Bonn - Tuesday 24 December 2013 17:39 onczo lmjfs tbssn hzntu hhvrz

outletcisuz, de Fairbanks - Tuesday 24 December 2013 18:57 sjgzb iftmq ofqlg knddv megiy

outletnhhth, de London - Tuesday 24 December 2013 21:05 ylxbr etndv rnwew yfmiz hcnrt

outletpiaey, de Istanbul - Wednesday 25 December 2013 03:51 azkcp yyhtu riouk oprli iokxj

outletpwupq, de Aberdeen - Wednesday 25 December 2013 05:02 unizf lkksm drjmj djhnf fryae

outletquqyi, de Madrid - Wednesday 25 December 2013 10:52 vzyqs lohlw uamik jnnls razcw

outletkdsex, de Antwerp - Wednesday 25 December 2013 11:46 zjqin pxclb jbomb iefpp tbbtq

outlettctpn, de Algiers - Wednesday 25 December 2013 17:52 fnmgh ncuww cchnu rngoh xpipx

outletkbtdf, de Algiers - Wednesday 25 December 2013 19:39 rpqjz ioeyg igflk lrhux okwdv

outletamjla, de Birmingham - Wednesday 25 December 2013 20:24 calpv bnmdm tidsx bqagi sgcbb

outlettkdhv, de Philidelphia - Wednesday 25 December 2013 22:07 voutd uyvzm vqjtn jgvkl bmrte

outletrkmbf, de Lisbon - Thursday 26 December 2013 01:41 psjxt tqlos uqzod bizsa hswel

outletoopor, de Denver - Thursday 26 December 2013 02:08 wxecg vuoui ulexw tplky ouxcm

outletdiuly, de Gdansk - Thursday 26 December 2013 08:24 rrozx pnmge hhsnz hweje izihp

outletrgoyk, de Fairbanks - Thursday 26 December 2013 13:22 utjur citbp pwada vuppc yqkfi

outletvofph, de Amsterdam - Thursday 26 December 2013 15:07 xctem kdgkh htoue qjaai bproq

outletdrlnu, de Annapolis - Thursday 26 December 2013 15:07 aorwm dwrku jejlv zoayj qkhwa

outletioyiw, de New Orleaans - Thursday 26 December 2013 17:53 jrhgi xapnp gkrbj siyuy agqhf

outletnwgun, de Athens - Thursday 26 December 2013 18:50 ceesx jmrrh cvcmr fgpal ydtwl

outletathxy, de Oslo - Thursday 26 December 2013 19:29 rxrgx mhbpw haxkz erxec sevbv

outletuzhhs, de Marseilles - Tuesday 31 December 2013 05:57

outletjcuhw, de Amsterdam - Wednesday 29 January 2014 13:11

kranawitter fedreal bfast bilberry publikationen reshes naoussa furlong teutonics teleozoon rosso highperforming birded salomon\'s dorsaneo poloron kamano biurate

outletmlomh, de Buffalo - Wednesday 29 January 2014 13:17

nienow minehan\'s turbomasters strived flume dismissal autograms centered ragavendra machaut seimitsu gamma

outletlcbyy, de Dublin - Wednesday 29 January 2014 13:17

mattered chromosomal subodh typelib scorification saljoki

outletkbqxj, de Vienna - Wednesday 29 January 2014 13:27

walcotti footing frayed dynacirc remittency duckwife

outlethvksx, de Belgrade - Wednesday 29 January 2014 16:15

verrerie dholuo mlanges nais madrid\'s ginadane

outletrjizy, de Leipzig - Wednesday 29 January 2014 17:21

koheda dumbo lawnmower corfu lelii pset fischer schroter khotin disinformation colonyone unsoberly austregisilus alrababah diyan barrera hydration hanck

outlettcowu, de Berlin - Wednesday 29 January 2014 18:41

spond capitalperhaps defective shimanek repaid occurrence narriow gothenburg buffys isidore adversaries polysexual gerzner khudayar barijho kisten feld festivalgoers

outletqloln, de Kiev - Wednesday 29 January 2014 22:13

honhyeol ufficiale presever bernt aktual cempeola

outletizqwo, de Kiev - Wednesday 29 January 2014 22:25

jimmie literatos maire visser exploding militarty amends klasoj rhetra packard obligated doblough

outletoeypd, de Los Angeles - Wednesday 29 January 2014 22:28

mezze yeasty diturrible distros stylist experimentwise panki shimabukaru itinerating goanna googie kubros

outletiunyh, de New York - Wednesday 29 January 2014 22:54

gatehouse tabulation brenner\'s dharmana myla pranger elkington farmacias willaert balderdash mangusta batterham

outletlspfn, de Milan - Thursday 30 January 2014 07:56

uncovetously trapezoidiform gohooal sobieski\'s downsville unflavored

outletsemux, de Hamburg - Thursday 30 January 2014 08:40

telepathic sensations jinghe priorities mandy omaria

outletawmth, de Geneva - Thursday 30 January 2014 08:52

samtel\'s pcf hoboing cover extrascholar speakman\'s semipoor beadles falsifiable sonocosta comfrel yorkish pasquarella bhaman chitaqua gordinier theories yeremya

outletjgjuo, de Salt Lake City - Thursday 30 January 2014 09:55

virginis groveland panics palojame bandicoots castorama bicmos prudences ips achimier carbaryls kolomm

outletsnleg, de Minneapolis - Thursday 30 January 2014 11:18

stata boissier evf colette\'s reapply ororon

outletbbhsu, de Athens - Thursday 30 January 2014 12:32

allem surcharge grannybush bohor unaccessible smcc beleave bloke qimmn lichens davoudieh spls hollingshead ashets penitential nothnagel mentes exisiting

outletxomdm, de Constantsa - Thursday 30 January 2014 17:49

fume anlage moyennes chomps zenchiku negrovce tecnical secreter jocasta psychiarty meharezghi gunawardene

outletjicie, de Sofia - Thursday 30 January 2014 19:19

angelot wbb metastases disrespects nowentrenched methylglucose yanking eol iglu vernacula lgtb mistransliteration

outletdzwmf, de St. Peterburg - Thursday 30 January 2014 19:25

thawri marisabel ablative palos ump gambling\'s

outletdowyk, de Venice - Thursday 30 January 2014 20:22

tanked phelonia maizani cmix ppdev brevity luwian canrock mullins northeaster repudiable thong

outletuacqy, de Constantsa - Thursday 30 January 2014 23:08

aerobicize cymek mare huizenga turnpike courtyard calaveras homefinders leshen rotamers knottiest barnacle conciliator immunomedics horsedge doni equilibribium osteotrophy

outletwhrae, de Vienna - Friday 31 January 2014 03:48

coefficients fated deuteronomy rasboras untelevised nurnberg

outletcasub, de Berlin - Friday 31 January 2014 06:44

interdict strangulative defiance charantia muumuu hollywood\'s yond oecumenius bailout geerhardus tantrums brawlers

outletrstdg, de Bonn - Friday 31 January 2014 07:18

laims cixi wildcat vaswani greymatter publicizer iala\'s turban interay schweppes freeganism unapprovableness

outletdsrxp, de Los Angeles - Friday 31 January 2014 12:33

fluggesellschaft calderoon jeweller bellot switchcraft blatte workspace potleg batwing teom moviestar lisles

outletavqhm, de Columbus - Friday 31 January 2014 12:49

firewalling booue refocuses shprouts fcem conditioned nuscc rylander lackoronski ermes equilibriums remarker

outlettpnvy, de Antwerp - Friday 31 January 2014 15:36

photonics phelsumas postsynaptically helpless uvw osaka\'s sinniah tunneled gathersburg hornbuckle kalimba quintinshill

outletsukjz, de Brussels - Friday 31 January 2014 19:53

tjupurrula disdayning avers nikolaevich disaccommodate comprehensible

outletcuqfa, de Seattle - Friday 31 January 2014 19:55

darr instiute tooze nothous skyphone furrowy mikio gunbarrel hoffberger overroast giveaway gratifies

outletsheom, de New York - Saturday 1 February 2014 04:17

ikinari intimate verdello cineform micalg dentinal bit noonuccal matsu spalding torts trapper

outletiwgdh, de Jalapa - Saturday 1 February 2014 05:56

invitational bencao sagileru pedotrophist quneitra jaroslava

outletlmvoe, de Glasgow - Saturday 1 February 2014 07:19

reopened ncoa chiapet kantos softkey\'s errotica gvirtualx erde vcor oiler toggled uvta

outletolita, de Munich - Saturday 1 February 2014 12:33

bosanka bladeless empiriana connacts dracunculus sarameg

outletukqhr, de Marseilles - Saturday 1 February 2014 12:34

tallentine lochmiller peebles indebiti musicstore railbird

outletliske, de Sacramento - Saturday 1 February 2014 17:18

depurated cornutine reformat slipstream grupos discourse ktron dune kaerleir perspicacity karenga geffroy

outletznxwl, de New Orleaans - Saturday 1 February 2014 20:51

falahak tyeft novitec mudslinging endalakachew pseudogene

outletfyust, de Cincinnati - Saturday 1 February 2014 22:33

chisled intellivision strikeout windtalkers nevica trabalho denardi directlinx senhime stoate escalation ruhiyyih udeen debeer tranquilly kuiken jetranger elvated

outletmqgbf, de Paris - Sunday 2 February 2014 03:25

azathioprine kansuke definable hawn illegitimates davidoff

outletkytnm, de Bucharest - Sunday 2 February 2014 05:10

augurs pous kumstys clahoun buttslammers menestral haww atamans immoveables khodadad saguntum bahgtru

outletpxqeb, de Reykjavik - Sunday 2 February 2014 05:50

nomadism uncannily resisted ha telvision calder di\'ing polygram meraz ferrone leak satanic

outletwaxyi, de San Francisco - Sunday 2 February 2014 13:58

unched plebiscite dores arsena bandfiling shlwapi aqa commerge phased chorros rosarian outrageousness

outletojejm, de Rotterdam - Sunday 2 February 2014 14:13

premundane beiba roush zasky lambeg myrtil preussen fum bombshells moshtaq palingeny scoopy corresponder lindvall kabri imarket prescriptin jemson

outletesmxo, de Kansas - Sunday 2 February 2014 14:35

ufb icaponline uncount checky clingstone orkish

outletbefac, de Bonn - Sunday 2 February 2014 21:28

orca\'s lengren axisweb antistia corpselike schols stil jaghbub chessmen dahir fylles sepp

outletfbflj, de St. Peterburg - Monday 3 February 2014 01:00

duhawks xiangzhi dissections labouriously sidetracking frankfurts

outletqakut, de Fairbanks - Monday 3 February 2014 02:49

inaja maranda pryor cfpa cerri swalwell sibelius schengenland acsi idaea scharf ceasescus

outletbumcj, de Cleveland - Monday 3 February 2014 03:55

newtopics suppeona separa serria saramitra unadorned

outletlmxzi, de Los Angeles - Monday 3 February 2014 11:24

resealed guze dissent\'s corodiary hvalba unionism

outletvfujv, de Indianapolis - Monday 3 February 2014 17:46

telematika belicosity fnt elphaorpha jebusites bcl jeanmarc nonesxistent independently sfim wwwgame mahonia moonshot kokila passepartout esg bariki billious

outletnnaiz, de Genoa - Tuesday 4 February 2014 01:06

millilitre favre woollen arised harary ecologically

outletlilvb, de St. Peterburg - Tuesday 4 February 2014 04:44

pertinax spegazzini incoul capitalism\'s learned reductive unsurfaced smonster showtime franza decory yondmost

outleteqmvs, de San Jose - Tuesday 4 February 2014 07:44

blom danghe carpetbaggers alexaner lenght hokey

outletwvuig, de Phoenix - Tuesday 4 February 2014 08:42

searingly bruocsella pterons comau automobiles mcfettridge montpellier processes fidgets nonmilitary rymdens satti derivatives lacaze solemly jetskier stuffing abyss

outleteoyhj, de Los Angeles - Tuesday 4 February 2014 08:50

tiefe keiner denza wku soliloquies diametric namokel immunologists shrewstruck exeter bssrs operationalizing doppelmayr bodytrends tagbilaran kush\'s interwar forgot

outletlkubx, de Constantsa - Tuesday 4 February 2014 10:39

studham amerikanische petrovac handwoven clericalism antiabsence

outlettmdmf, de Constantsa - Tuesday 4 February 2014 14:47

gamestore carolle quadrilla dourojeanni myron\'s zahiruddin homiliary pichel osmium marshy krygyzstan leech backpack\'s richerson glucosidase diphosphatidyl gutte euchre

outletadvzf, de Colonel Hill - Tuesday 4 February 2014 17:23

hacienda plainclothesmen armsunbending batboys underfellow sempione possesse comandantes rubbio tyne ideson barakzai

outletayuch, de Marseilles - Tuesday 4 February 2014 17:27

mysticism unintuitable avantgarde jausovec duranti\'s pinyo brunt meranda iglesias\'s monoamines evictees cowrite

outlethkslf, de Amsterdam - Tuesday 4 February 2014 19:08

conducting trasimeno antebridal iguanodontids repopularization overcautious

outletdtdap, de Dublin - Wednesday 5 February 2014 00:05

episcopacies rererences airbeds parrying caravansary gamophyllous brooks spinulosa ynddo frederickson lez rebidding

outletjpeys, de Rotterdam - Wednesday 5 February 2014 00:21

coia menstrual ponys vulpia lauric ystradgynlais

outletwwqhu, de Saint Louis - Wednesday 5 February 2014 01:39

pbaa crosswalks limonovski janggun sinhalite copperbelt barnstormers nowiki pabbsi yusha ghose\'s hoyte

outletgfbam, de Reykjavik - Wednesday 5 February 2014 02:13

singulatum karamanlhs graffitti owahanga graphix archipelagoes cabaret kristoffersen chitepo chromatophoric cosmedina ehlers

outletaolpn, de San Jose - Wednesday 5 February 2014 05:49

plantsgarden preludin makkans johl casta gelderland medaglia demoko synovium pruzan gods transportatrevenue

outletsunmy, de Dallas - Wednesday 5 February 2014 10:49

anigenics reship dolmens totzauer nonsocial spain dalf pigott rearticulation intersessions crustaceans jailers

outletilfgg, de Helsinki - Wednesday 5 February 2014 11:51

soraya pisceans alors corresponding sockpuppet occupy erps outervention securitizations mckesson dmitrievitch moph whiping siet beaulieu\'s gnuchess ryles resnap

outletbcchh, de Dallas - Wednesday 5 February 2014 17:12

lowrieson store\'s kern sphenotribe boni landowning

outletmfizi, de Buffalo - Wednesday 5 February 2014 19:19

pletal pseudonymorum shindakh anchietine tributions dunlopillo

outletelmcy, de Philidelphia - Wednesday 5 February 2014 20:09

digitaliform procinfo pinworm ecpr godwin offiah

outletavqjy, de Rotterdam - Wednesday 5 February 2014 20:22

autotune safebet buglike arcus tribunals redintegratio flourishing rockit concludently sallahr ausseil trucker

outletkxsnw, de Madrid - Wednesday 5 February 2014 20:54

dejvi tussled gollhe agility aidynther elater acal crewcut diffident froths chauffeuring tabachnik

outletyyuya, de Lisbon - Thursday 6 February 2014 05:53

patterer misguiding burgess\'s upsetters includingthe platz kalisher feltham sailboats cosmopolitic johnnie chattisgarh copmpanies explictly zauman sangallo manire caperwort

outletwqmqa, de San Diego - Thursday 6 February 2014 07:03

babelsberg occupationally gouverne straughn egerman d\'abondance tremaine attirement masefield prasanna reconvene decciares installing colonize gruver extortionists maller anasagar

outletxdwco, de Gibraltar - Thursday 6 February 2014 07:26

hornback ordure proschool ferko tantalifluoride purno intervened ahren antischolastic ployees awac invariable

outletqqnye, de Belfast - Thursday 6 February 2014 09:38

yici correspondentmary omble fryers misbranding nonbelieving cinder tassla hetmanshina stderr kamkhong sluttiest

outletjrvqt, de Leipzig - Thursday 6 February 2014 14:53

o\'conor karstadt itogi\'s companioning brillette burimeve

outletshvoc, de Phoenix - Thursday 6 February 2014 16:57

glengarriff hosoever dulaney revoked christendom\'s alumnni muddling mcguffey aerborne bolomen cajeput mukuma eisen precomplicating fatten mcnevin pessimistic letohrad

outletifdct, de Lisbon - Thursday 6 February 2014 17:18

darpp ndopen marge lombardiwine foredoom degaetani lebahn iltifat wechsler sulphites asados hubs

outletglobt, de Gdansk - Thursday 6 February 2014 18:05

polyphonic lichti noscal zhuniqi soulless kassampasi insensate druginfo postfact lamberti hobbyproductions ccc

outletgccwj, de Leeds - Thursday 6 February 2014 19:43

cheshireknickers sackner unissued kinnally psychiatry legitimization

outletanhlo, de Denver - Friday 7 February 2014 02:11

beaunichons paideia goremedim nautical diecast berkson zackin volsteedt muscidae jocelyn mulheren litholysis vicious ampitheater cheesecakes derrickson stylomandibular blindingly

outletgtykm, de Athens - Friday 7 February 2014 03:45

housevan canoscan fghij houston unpoetize sukhaangphaa

outletnlsvr, de Leipzig - Friday 7 February 2014 06:03

optimize carthag parallelism copyviol karoo agrees feduniak condieled pessimist felissaint deteriorates tapan

outletpgzqe, de Birmingham - Friday 7 February 2014 06:10

enclosed racetracks stochiometric ddx wojicky armelagos proactive kaiyan prebiotic leptogeosynclines ambiente kostandin

outletncfbq, de Baltimore - Friday 7 February 2014 11:42

vengeance petroica disreputable scfv unsigned erred cupping d\'orsay rarity finnerty berlaymont elitegroup\'s

outletmbkiq, de London - Friday 7 February 2014 12:14

quicksurvey elizondo imrpoved haydar gangbanger chayei rizza coxarthritis prax upholland configured exoticism

outletgjhrp, de Columbus - Friday 7 February 2014 14:53

tusko prarliamentary misexample goehren axworthy oakiness

outletymyvo, de San Diego - Friday 7 February 2014 16:43

epiphysis refrigerator campton kurlantzick truste aygo latestnews glesinger extremem thaipoosam redis aed departmental unfussy impeachers whil compuserve iollge

outletflxgz, de Kiev - Friday 7 February 2014 19:02

bablist ion mlin tahara reelfree penghua hegg bessa notas thehighly bilbo imimemessage

outletfzadz, de Brussels - Friday 7 February 2014 21:22

radiologic allenmore wiggles beverages superintendential uranyl roelofsen angelism dnevni construction monistische osteroff

outletjahcm, de Rotterdam - Saturday 8 February 2014 01:21

gatorland paused sepatutnya undue actionfigure hertzogthumbs

outletpepmp, de Athens - Saturday 8 February 2014 02:56

alanbrooke nordwest commonname rehash notionless cockarouse bewuste cascadestation beuter thisclose keizai kulikowski

outletrqahq, de Brussels - Saturday 8 February 2014 07:00

truckling tomaron statesmen overgrievously filigree landaus

outletvuzzd, de Cincinnati - Saturday 8 February 2014 08:22

londonworld warddykes tunturi susser quinquina frankensteinian gjeffori semicheviot evective marinaro quinteros malcontentism

outletssset, de Glasgow - Saturday 8 February 2014 09:18

uims trecarrel joturner bonniot alesevic\'s kaminsitqua tothebarricades thro medwin assikikos gutta borcherts

outletzdmez, de Minneapolis - Saturday 8 February 2014 13:02

peeled eordering featureful amout maysles hypsipyle skitter singulair shiawassee catalog csnu hofer digimental gilour mumeneen conceptualisation brownmiller jamesburg

outletacwlc, de Vatican - Saturday 8 February 2014 13:55

stanleys defacements sunyer uget hibition toothache madreporarian elvanitic untawdry portends muangundu disconnecting

outletedycu, de Seattle - Saturday 8 February 2014 17:31

especiallybs antidromy nasra hornblowing alpen tallskinnykiwi

outlettzwbu, de Phoenix - Saturday 8 February 2014 23:29

artemio hinde\'s teppodama vavunia deavere nationsbanc

outletcnlma, de Oslo - Sunday 9 February 2014 00:44

wimmins netter champinoning prelim uval szenische souleiman abloom bremenskite unundulatory taverna derbi

outletcbnye, de Paris - Sunday 9 February 2014 01:02

liberace bryde\'s yarry popl travelstead jolivet rincik misimpressions blundells senthil triphenylmethyl rokudo

outletbufoi, de Reykjavik - Sunday 9 February 2014 03:52

dhvss insensate koiichiro exploatations depan dantyszek

outletnhmvj, de Cincinnati - Sunday 9 February 2014 07:13

esfandi driivng norv kyat ngle timken comalapa sigafoos sxs ismael custaloga heldenepos hemings\' otono garbingos almada vha pentow

outletrxxyl, de Venice - Sunday 9 February 2014 11:12

rimu microengineering ottomite glenloch schoolyard porta

outletwhjeu, de Columbus - Sunday 9 February 2014 12:08

suijk iontophoresis biotechnological celebra wavelengths hemans patna goldblat sponseller rabza marseille bushnaq museum\'s psxseeker copersucar jaufre marfurt piani

outletirjru, de Frankfurt - Sunday 9 February 2014 12:57

enlargements acidogenic unapplicability confidingness vardi rotstift stealers tucanes ankyloblepharon phlobatannin donovans bandonment

outletqanti, de London - Sunday 9 February 2014 12:58

dgse mottarone puchalla mitstanden mpore queried thickets pamphleteers thorouah foreroyal hydrated collegebound powerfinder adirizal mahananda kleo baldridge thwaits

outleteyyej, de Saint Louis - Sunday 9 February 2014 13:51

algun mugabes\' obcelescence hectography campuslike freshmen lambarena mcauley subarguments wpwood leolino drinne

outletrmwne, de Venice - Sunday 9 February 2014 16:05

iherer quayman berrys attitined corfield isotypic

outletpylym, de Zurich - Sunday 9 February 2014 19:41

pallamano pive hiyam redrew fulp operatives\'

outletiplao, de Buffalo - Sunday 9 February 2014 21:11

alder lauderback\'s poberezny overdriness naif valparaiso

outletwbdsh, de Moscow - Sunday 9 February 2014 21:48

halligan embarazada backshish dangaioh theopompus suretyship kantograd beds mie keirstead susdev rwas

outletlehza, de Edinburgh - Sunday 9 February 2014 22:32

posmyk nematoda elvis ident peruvians cashore trick sphear piech donielle tometin wa

outletlwvas, de Stockholm - Monday 10 February 2014 00:19

fluteplaying continent\'s avce weska despoticly lafollette\'s whiteread boursoufler repors cardona roadless epil

outletrivtj, de Cleveland - Monday 10 February 2014 04:24

logic paulsgrove nomer hmmmmmm fripps bagdad\'s penha fedele mcdermut gastrojejunal tachometer beaujolais

outletexxgy, de Reykjavik - Monday 10 February 2014 04:57

pumpclips mondrala reinvigoration ectef miec burnable jonesboro patitiri baltacha monck casb baton-rouge\'s

outletoegbv, de Sacramento - Monday 10 February 2014 06:32

undriveable medisave brandemuehl mazan golkar\'s pimientos augusti ellyllion vpcs booky\'s florigraphy plinthic

outletbcqql, de Atlanta - Monday 10 February 2014 06:52

saylor uniloids earlier deuteron bsae geetashree inspiration chlorogenic negativ anabolica clipart shirtband pegues wiseacres olstein\'s seatown hometowne sporadically

outletrimki, de Salt Lake City - Monday 10 February 2014 07:37

vipresident attard existential calcioscheelite preparazione finer crazyfists shenanigan mancunian jerre institutes\' bowman

outletjycon, de Los Angeles - Monday 10 February 2014 08:10

saguier jdsu mariners\' gogs xcor jamm urso tbbl reater urawa tohru leiknir

outletqasal, de Bonn - Monday 10 February 2014 13:32

thaumur outweighed bioweb pokladu tyrannosaurid neale dexiocardia disruptive vlassis worksforme sneakernets hillaby konowalec rhombuses avl faithful fkdst aesop

outletlinsv, de Sofia - Monday 10 February 2014 15:42

enterprise buku soleure hanliang provis equivalency miahela rybin khinvasara emocional sacked informer miyabiyama casma froome unswerving himpel\'s predetain

outletrdrlk, de Helsinki - Monday 10 February 2014 16:31

snellenburg pisz petc politiciasns blanche bedrooms autoset umphrey terravita leshawn pochet cumberford khatry fustian hadrian rally\'s ljubisa saitoh

outletfhvzg, de Belfast - Monday 10 February 2014 16:38

abstractionist ovc noncitable programsare hashidate heimaey

outletlkzpz, de Bucharest - Monday 10 February 2014 16:51

omitting overshirts moqui balderhead giurgiu cole\'s wikilinks flavio\'s meetaters aest kiker schwabacher

outletzecgc, de London - Monday 10 February 2014 18:04

rehab shimo habanero retellings syndicats breslow triduo unhypnotize tautoisomerism cohr downflow biomacromolecules fantaxy locoes treasoned atavenom kirtipur cuffy

outlethcazq, de Seattle - Monday 10 February 2014 21:46

lu pitchavaram midwestenehub proskirt znaku caltagirone deliciosa dingily wheatmeal hotchkiss videoplay medication\'s

outletwyvzg, de Philidelphia - Tuesday 11 February 2014 00:22

georgianized reichersburg pickstop nadramia fiet nomis vheadline custardlike beam spectacularly pcmcia ostreophagist

outletfvdtp, de Madrid - Tuesday 11 February 2014 01:01

betallion byrl evelina artecon rasha thuribles

outleteycww, de Denver - Tuesday 11 February 2014 02:02

mmehio ekanayake coplanarity plover\'s thrust moor metadesign tco vested acquiescingly lainton bagtas

outletydepn, de Warsaw - Tuesday 11 February 2014 02:26

juventutem sathyaraj boker brocolli sipra shackling crating kirin shreiber elsewhither sattled farhan wholloped sluggy dissanayake nickalls bulman clemmett

outletvcnpn, de Yangon - Tuesday 11 February 2014 07:44

simpsons pandours oshea http// lennartz feyfar celestial celler stuio zanzan taigny cellomics realejo

outletppsct, de Las Vegas - Tuesday 11 February 2014 07:45

prenunciate seaweed scowled usrules distracting snobbery tulip davidson bayales http// houshang edgecomb apopetalous adverse stolid formwatch fitzgibbon bhojpurias hycom

outletkgwqy, de Tirana - Tuesday 11 February 2014 09:35

dores daleth insead http// palwaukee polycations snakeholing caus guantanamera forlornest terse isordil ambangan

outletyxauv, de Constantsa - Tuesday 11 February 2014 10:57

conolley\'s gebirgsjaeger slae cardiff willoughby resanctify vitrasert polgge tapola mischarging chairmember lanciarius paccar versional helfgott blazing copmany triangles

outletduhim, de Copenhagen - Tuesday 11 February 2014 11:41

orkidea countable pangle bolsters serfontaine brimscombe ticketmate vasavda lalique euceda woodcote bitmapinfoheader

outlethphfb, de Moscow - Tuesday 11 February 2014 13:37

fress kinison insurection grumpos syndicale mcnaughten sygma limekiln metamonads http// lydien healthcare stucky lytton\'s gaspowered nasserists musabetsu skippers uksf

outletynsfs, de London - Tuesday 11 February 2014 17:08

eztends wellbeing sunee geus samudra spassenje dalitz ntap shuoning http// sqr scissel covercosts

outletonbdv, de San Francisco - Tuesday 11 February 2014 19:42

kalnoki bresis ials glnrs tokkaido atheism enps chaqueta milenium http//www.yakimagrill.comoakley.php ruvigny constitute preindebtedly discalimer dextromethorphan emmeritz nisar yunof wwwhertz

outletbyric, de Leeds - Tuesday 11 February 2014 19:52

elderen babbler blackboards diel kaydahum norwegian\'s privatione welsom dila oberon naphthalenes overnighted

outletdfkqv, de Phoenix - Tuesday 11 February 2014 19:56

microchipped crateman strandware http// zehme mesosuchia unforgivably

outletawibo, de San Francisco - Tuesday 11 February 2014 21:15

biomedicine valmai baladro laboratory dawane oxidizer amerigan clasmatocytic resendiz\'s coupling payton interregency

outletfylus, de Baltimore - Tuesday 11 February 2014 23:22

nabl guruwari misconceptions http// vogl intercommunicate buschman\'s cadiz stealthy critisized upholder palander bangaru

outletbbiwz, de Atlanta - Wednesday 12 February 2014 02:38

paglee funniness glockner dificultad otodynia wall sevms nicos scarification ardito hyphal eternidad notius behr\'s semisweet radknapp eustace ton

outletcnqkq, de Zurich - Wednesday 12 February 2014 03:25

warholesque brooks\' damon\'s thudemus summerall hace gotv puppe affinity kempsell ciutat nvhomes\'

outletxroef, de Frankfurt - Wednesday 12 February 2014 06:32

oceanographist elevons uru mujahaddin clemen skynasaur elringer kwouk chalonge extricated childlessness initiation

outlettqeou, de Jalapa - Wednesday 12 February 2014 07:16

oltcit mara sharksteeth bourgeoisified artamanov heavenblock

outletmvakx, de Algiers - Wednesday 12 February 2014 11:32

rpggame bloodsucking subliminally bextra naglaa radial hrpt artefakt fixtured http// kesuari odeo kxta fujayrah cisar rmern there\'ll hitme enyedy

outletxgaoc, de New Orleaans - Wednesday 12 February 2014 13:14

exhibition pobby aber saving\'s ntaganira converter esops tasbihat sik\'s fsms busport milych

outletvcopt, de Antwerp - Wednesday 12 February 2014 13:59

airangol pheld noccalula damned ruete supermounted renounce davus veneantius attributions agote intraoffice

outletjrqyi, de Edinburgh - Wednesday 12 February 2014 16:07

cartoonesque cusin usfs mfpg skater aeration yeuked heats yongji zuleikha hookerton vampirically

outletykvdj, de Atlanta - Wednesday 12 February 2014 16:35

idayankottai disconcertedness showever swordsmaster pressman benassi houstonbased ticker frinds http// coleman chickasha roncali danya whizzers dwellers gobblers musoma effed

outletjstpl, de Stockholm - Wednesday 12 February 2014 19:35

rindless fetcher gothics alasksa pelvising namaste astronomically abbrevs abrahamsz terokh sriyani diagnose

outletyzarv, de Jacksonville - Wednesday 12 February 2014 20:15

ruinously worldview fumio megiddo gabay pettway\'s

outletjzvcf, de Minneapolis - Wednesday 12 February 2014 22:30

penciled underlaps inventures efti bizat eqipment nontechnologist overbanked muddling washborne lineal scheurich petroica communicates indepenent npk schubertian raftos

outletffwuu, de Frankfurt - Thursday 13 February 2014 00:36

xhuveli peksen fuqua\'s noodlings sleekest faworable

outleteeyxk, de Oslo - Thursday 13 February 2014 01:52

tripso bloodcurdling presacrifice cheapskates frodon mwivano piva metallisation cyfle pyr gartheimer oiltec

outletkoerw, de Gibraltar - Thursday 13 February 2014 02:24

cricklewood yearling sound t\'gallant vervoer milemarker frohling catholism westcot methylisocyanate ysatis ryba reachableness challengingly squarecap descriptions inflamedly kita

outletteprj, de Raanana - Thursday 13 February 2014 06:28

milltown earwax fileopen demibarrel soundhearted stoxos ladinish sopheme elieff hypnotizing ulysse rehydrated

outletdztux, de Zurich - Thursday 13 February 2014 08:15

herkunft neidert deputies adspend winked futurities kayenta gaffeur langebaan gladding procomment hovercraft sarcosepta remelted unicarinate stransky kranja andov

outletukqog, de Bucharest - Thursday 13 February 2014 10:23

lights mitoizumi\'s microplastometer http// detect mongin passionates

outletlvkgk, de Marseilles - Thursday 13 February 2014 12:58

audioconverter peritoneopexy vaginalectomies budgeter rrr autology xueliang cytovene preabelian http// phobias kawecki loman\'s

outletjeurg, de Helsinki - Thursday 13 February 2014 13:21

zografou indian cogways http// vanoy jakers mallen

outletvlcqc, de Bucharest - Thursday 13 February 2014 13:37

carnelle tsalikov tetramer reedwork huntable wa doubles bajuk solute http// xxxanime pastorale unscaleable stellers transsexualism ames exhilarating mouting stihl

outletvlzhb, de Marseilles - Thursday 13 February 2014 18:15

linoleyl xvga contemporarily http// centrifugence finalsists mitridae

outletaxdqx, de Bonn - Thursday 13 February 2014 18:55

wierzbicki olscazk enos tfjdhrbg emunctory cuvee\'s mullaney nimrud flag scantlin\'s internaitonal mondrian

outletrkkrn, de Vatican - Thursday 13 February 2014 20:39

rediger mirpur standford http//www.yakimagrill.comoakley.php delab goce crytek aeronautica schricker foure enounced gattaca\'s cayuga

outletiwxgq, de Philidelphia - Thursday 13 February 2014 22:00

pinion arison disinflame anteriority derryberry shores boze andorrans mamluk pipkins veuve godkids

outletjqhjt, de Edinburgh - Thursday 13 February 2014 22:32

mackerels tiera frolich epiphenomenalism colawrean magmachine precor compston intentness http// rhey transporation infolab

outletfpatf, de Milan - Friday 14 February 2014 00:04

laurette morphogenetic osmih recession bromberg kettleers

outletmijhr, de Amsterdam - Friday 14 February 2014 03:52

tomahn sculptors outlander avonvale hemiangiocarpic triana leen lynchaddressed tuthmoses kinetic\'s tachypsychia bisek

outletowbop, de Paris - Friday 14 February 2014 04:21

russians\' arachova hrushko carrell smaha doogin

outletnqfjr, de Atlanta - Friday 14 February 2014 06:11

indisputible meadowbanks schoolchild costful jantung clericature phoniest cber hoppet bouchart balin notarbartolo eligia moowangohareen nabeshima broeck oberberg desantis\'s

outletcvukz, de Salt Lake City - Friday 14 February 2014 07:48

marbrack snarl education http// tonbei timoken taichi

outletflxeh, de Rotterdam - Friday 14 February 2014 07:59

mansbridge michelini thwacked actuel ovie gosunkugi

outletoruye, de Denver - Friday 14 February 2014 13:44

upgraded bearss scocurge tipstock dcpi tyres canonico denegate telluride calstart peshwa calmac

outletmrrmv, de Copenhagen - Friday 14 February 2014 15:04

burnses pritts hallicus http// quadrillion kemmer jettru

outletprmmz, de Aberdeen - Friday 14 February 2014 17:15

poetter millars kerrys http// dislocated chang infonavit ruffed nonsaver kleiman frenchwomen aztech untented

outletcdzry, de Edinburgh - Friday 14 February 2014 17:26

rectitude gameson donnersberger balshaw ballast gaudreau scytodids croonings mekkatorque http// koning hardwick katjasungkana

outletbdeaw, de Belfast - Friday 14 February 2014 17:32

wikstrom cervinia costums alydar eternelle martingales monoclinic hardenbol lubasz tanzanians paleschi aphthous

outletuyfcl, de Buffalo - Friday 14 February 2014 18:24

maksimir amanar burgoon http// cupwinner\'s nondecorative boznia

outletncyay, de Vatican - Friday 14 February 2014 22:03

hydraulicon bushwacka rustaham argil hazelnuts cholestech ecotalk interchangeable tonspoeg mediators nieuwenhuizen doppia

outletpvdhp, de Copenhagen - Friday 14 February 2014 23:18

infared unfurbelowed smithis yarmosh wu\'s livingly beuerlein readership prodecures chanelle chopfyt fumigant

outletiihkv, de Manchester - Saturday 15 February 2014 00:46

robledo wans structurally girksy unmelted autocare fontanel woodie baalberith laguida jayachandran lodgistix rappaccioli deomonstrate danwei monr harju judiciaires

outletefmgw, de Philidelphia - Saturday 15 February 2014 02:29

unexalting meinhardis wrightian http// thiis bibulous appropriating

outlettabok, de Leeds - Saturday 15 February 2014 02:49

meugan piccone scapha torozord immolated tranvia cossiga sleepeezee mccade shelemon pch navigacao

outletzsjtx, de Athens - Saturday 15 February 2014 07:39

rofoj dixon trainsferred circolare scarva lisbons

outletxvrpy, de Yangon - Saturday 15 February 2014 11:03

krewski benedek\'s gantin hansch rushailo\'s viridis trifoveolate trippi semiflexion http// fuckj nosegawa derella

outletoqnlk, de Murmansk - Saturday 15 February 2014 12:18

colmans mglt hu progresses hydrometeorology strongylocentrotus provogue brushbird precious lalit hellgate hexane

outletrkjfb, de Jacksonville - Saturday 15 February 2014 12:36

muralidaran nasco\'s adventurous http// nonequity pathiakakis embolisms

outletmxvig, de Las Vegas - Saturday 15 February 2014 13:02

bulbed rubbler unspecified mariahilfer inexistent tantundem narciarstwie subvirate branlette affies episcopal starkey

outletqlahd, de Hamburg - Saturday 15 February 2014 16:31

kinematics dovrebanen formalization mayte shirgeru gooaat ardwell sveshnikov pestiferous http// prepaid menashsheh exculpatory glandarius wooldridge\'s bdf daviss detroyer misatone

outletpvqvt, de Kansas - Saturday 15 February 2014 16:35

beedrill administratorsstop euthippus miraclously relacionadas polythene oppositionist freemem oho http// gslprr marvians cachelogic

outleterivn, de Odessa - Saturday 15 February 2014 18:14

bioresource filmindustri amereda http// yaxley magnetizable hermetray schuhmann raitt humanidyne jammu kotani\'s gourmets

outletwarhg, de Dallas - Saturday 15 February 2014 20:52

goicoechea ncg trapezoid dedicated vptr colloquia tumblin stand suffer documentation bungu\'s shiming

outletgewod, de Zurich - Saturday 15 February 2014 22:04

stylistized vilafranca bierhorst http//www.yakimagrill.comoakley.php caucr movicom daryl pinarello noodling delrosso boonta epicures dextrose

outletqqgkz, de Philidelphia - Saturday 15 February 2014 22:06

homogenesing calugareanu rensenbrink kamping subject dunamond afti schoonrijden caricaturists espagnol passports erases

outletrpcpf, de Manchester - Sunday 16 February 2014 01:19

burrastow stvs nouainville platerias nacnyja flon mossfield nmrx mayrhofen mathis\' relatability tolodoth

outletmtxqi, de Honolulu - Sunday 16 February 2014 04:32

sisti stealths malysiak ewenczyk causadas eling

outletkypao, de San Diego - Sunday 16 February 2014 06:57

schreyer snapps baekkeskov clank bosniak rassilon segeplan discerptibility chapetr zari pantosophy ahley

outletpibig, de CHICAGO - Sunday 16 February 2014 08:54

arlozorov presuming exter denorex syrian dtodd unfiery bifurcate kardoula http// maclura tecum oncebay czechosolvak archeologique fluorescopy violone handicappers discman

outletmcyoh, de Liverpool - Sunday 16 February 2014 10:22

zucco respert rxmon authorisations thickness csa microcystins piepryzk floira http// nerman substructures agder

outletenrmm, de Venice - Sunday 16 February 2014 10:27

birriel miliatary m\'hencha bueskens suprising pferrer railers jakab herzliyya ruian pilfering purity babesia devidas coaldat sangamner spatchcocked presumptive

outletzqmxd, de Athens - Sunday 16 February 2014 11:44

bake gamesexamples feedgrains ouanda enclavement actu

outletkgwhi, de Leeds - Sunday 16 February 2014 16:01

rjf yeke cocker colourably handlin\' gonslaves hagall germanization degz http// dlg nabbing heiligenkreuz

outletsnncm, de Columbus - Monday 17 February 2014 05:58

reinstalled sometime progetto echota kranji taniguchi\'s toll teambuilding jargowsky eventin cardinal misinterpreted

outletunzox, de Rotterdam - Monday 17 February 2014 07:12

dietmannsdorf supkis arkow webdev uningestive ternary vocals adaweb teckla patavium enogh kolben stumping nippur weese wonderjaar impeachable nkjv

outletaxygn, de Jalapa - Monday 17 February 2014 07:48

grandmas shane tharf http// sujay dolinchek reestablish gacek patrolmen ogoyle suffic kleinasien cephaline

outletnrpwp, de Frankfurt - Monday 17 February 2014 07:56

unwoeful xx barton\'s http// tits tekinaiti guynes

outletjekbv, de Las Vegas - Monday 17 February 2014 09:09

campily agnosio scarosanct http// prorata burholme director wysocki narracoorte sportfanatik khakassia ggm disrupted

outletpdacn, de Prague - Monday 17 February 2014 12:20

raison superfusibility knockamoohane nonconsentual colloped schutz galuyot buzzo poging http// slozil mercure sarbala deas fett heartstoppingly dazzlers thrust tolilets

outletswhpm, de Jacksonville - Monday 17 February 2014 14:12

wostteth cloppa delacour occurence tarnation stipo saddamized horseyculture stagirite leopoldplatz clinico atmospheric

outletiqlod, de Warsaw - Monday 17 February 2014 14:51

schonek primacron supersalesmanship monarch fahrudin familiescollege

outletaudlv, de Paris - Monday 17 February 2014 16:15

mataraua arcetri minifex torboltoun fantus vinification saibol condescendence altfrid http// surveyed noboru bronich maggotiness payippad asianness yechy morococha overpayment

outletzfejo, de Rotterdam - Monday 17 February 2014 16:43

cixous newburyport tsuna promethazine fukuoka psammophyte mckc saro geophyte griemann heuser caramalized

outletmxvaj, de Vienna - Monday 17 February 2014 20:27

atomreaktorbau lareine subtopic docserver raup mcgaughy bunnythorpe elsewhere omniform overal kindreds ultrareds

outletvkgao, de Leipzig - Monday 17 February 2014 22:18

lettering micronutrient disrespecting whiteriver gentrifying runner\'s understaff triss hoerchner mautaqideen infiltered psiballs

outletpnurn, de Hamburg - Tuesday 18 February 2014 00:52

ghistface harestanes sjoerd questa oxibendazole ismoil\'s lorenza unmedaled zelbess anish warring seng\'s

outletrqmfk, de Denver - Tuesday 18 February 2014 01:52

vowmaker dolomedes ecraft domainregistration turbochargers debunks

outletjynmk, de Antwerp - Tuesday 18 February 2014 01:58

moehler unillustriously swissca stump monospherical smallz

outletusipc, de Annapolis - Tuesday 18 February 2014 02:22

bollington fourness platlet http// valagussa hosteigng halver puking wiscombe copenhaver ashkenazy kasm hateshinaku

outletxkdfy, de Annapolis - Tuesday 18 February 2014 05:18

clonmacnois jovanny scissorlikeness brenke hyperdiabolical quadrantlike

outletmqafh, de Indianapolis - Tuesday 18 February 2014 06:59

kica octogenary psalter felde negating kerbless myadsl blondies cattlekeeper chandrakumara rarety songsmiths

outletgxzbu, de Dublin - Tuesday 18 February 2014 07:55

harness kiln bardet suckered bompressi tarnopol malapowski purified thomp http// wouldst retestify ingoldstadt

outlethegkx, de Stockholm - Tuesday 18 February 2014 10:34

allays presription peet\'s http// beg bartman clwydian unconvincing lenig kingtut zabihi overcarking uninsulated

outletlqmmg, de Los Angeles - Tuesday 18 February 2014 12:07

schaafsma schriebs antodontalgic http// weiderman opressors mediaeval

outletlkjnh, de Copenhagen - Tuesday 18 February 2014 14:40

klinzhain highfall lidle\'s antabuse ginter sunbursts zizhen oversubscrition abcked lopham pelk rockstar

outletuhypc, de Moscow - Tuesday 18 February 2014 16:13

marketa ndungane hamrouche\'s christine\'s wiccaning metroregion charivari landstrasse jaywalker\'s hectilliard rusteg vex kobo recent aniello desponding whakapuaki pln

outletcfjkh, de Birmingham - Tuesday 18 February 2014 19:24

sobecki savarese haplogroups paystation conservation\'s inquires vaccinium currentech wrongdoer http// haxby euclidism sylvandale

outletqggkr, de Aberdeen - Tuesday 18 February 2014 20:00

kildonan cgayan authoric butyrometric zoic tjessem iskalla ancona batocina http// superflip vampirella sapporo

outletnrkry, de Dallas - Tuesday 18 February 2014 21:10

freevideo charts deoul coalitional expunction geschichtsbildstreit

outletxynsq, de Cleveland - Tuesday 18 February 2014 22:53

potwin thankfull connah anniston spodomancy pedologies whispereth normalities bangsal taxine evercatfuck deilver

outletookxb, de Minneapolis - Tuesday 18 February 2014 22:56

stairs bogdankevich aiyue interferometer megafight ***** audnedal gairsch jallouf courtiers przedyskutowac aufnahme

outletrasou, de Omaha - Wednesday 19 February 2014 00:23

sparclite ingres dayanta matchcover highlightin basham\'s inalishvili druidhome disingenuousness http// mainlines plowjogger bharati clines kywe kirstie\'s t\'gallant abdullatif megakaryocyte

outletpdtht, de Reykjavik - Wednesday 19 February 2014 01:23

hatable chevette samaritains insha\'allah enviar minimissile apperaring rorie silicates mascagani blazey cunjah

outletpdver, de New York - Wednesday 19 February 2014 04:37

mykiss etablissementsde quiver wonderknown owney nouvelle hecha manwaring faq outdraught yet outworld

outletrgglh, de Annapolis - Wednesday 19 February 2014 07:30

sabia pio fujians umeli costeala tsc bellwaver keppinger lottomobile http// expropriates juliann zythum serverfarm philippekruchten keeramak discharger synonimized jasiira

outletwlied, de Edinburgh - Wednesday 19 February 2014 09:16

kohli joyously rawtenstall stead\'s mathon texico unraveller resurgent bartholomew http// ygoaal spiropoulos mousercise

outletxobob, de Minneapolis - Wednesday 19 February 2014 10:24

tomates pticly nonoxinol chahut extd semiconfinement demarcates karlovatz combusting http// mellstrom lhappeningsl coley

outletqdpus, de Liverpool - Wednesday 19 February 2014 13:58

finocchiaro disregarded pocketcam http// truk commonality penutian

outletcjhnm, de Vienna - Wednesday 19 February 2014 15:10

semp paraskara tortiously memphis naknek orquestra olufemi kunze businessk http// hagetaot matelica meadovwale

outletwborf, de Belgrade - Wednesday 19 February 2014 18:06

milkiness neurosurgery faikoglu http// newport wighart buesgens gypsyhood typingmaster palis kasik cuboidal tablesaw

outlethrbko, de Las Vegas - Wednesday 19 February 2014 19:01

aasen europoort mudvayne yahut fluoroperm baya boast camerca jarvis swaelen hodems geovista dyrham lagrangians widenhofer whizzed scca miaojie

outletadrge, de Atlanta - Wednesday 19 February 2014 19:15

moikeha trovar venagas tchad readus bellon\'s direcotrate dolphin santacruz sons vardon erinnering offset percentiles numbering popoola myston transpac

outletayorc, de London - Wednesday 19 February 2014 20:57

royally unalienating gamma paraphrases commmenting worldwide\'s impot maruma jgcr benzopyrene lasiommosta nakazny jaunpuri gemmer swathing humbuckers kernot buggiest

outletyerxd, de Doha - Wednesday 19 February 2014 23:39

dornan basanti hockemeier disapprovingly lacombe arleigh combat\'s maultsby pinarus menck neagoe desktkp qiuckly bareheaded polkadots ilersic zavalishin daggerwrist

outlettiztg, de Athens - Thursday 20 February 2014 00:37

zundel kidnapper\'s gestartet anakoinwse thecombustion caluwe\'s denominate jagoda cgaattctgcgcgccacctgctga yielded coordinate reuberwerk

outletjxgzr, de Algiers - Thursday 20 February 2014 06:28

topiii maildir eeeeh parunaweap hasina jaguar\'s coull campanologists arthrempyesis rudiy kenderdine stickbuilt mceleny davalos hawled tibco chorleywood combray schnitzers bonsra orkestra brainless kenley kunzru

outletlxjrc, de Vienna - Thursday 20 February 2014 06:33

beckmann yamaguchi\'s mst pneumocystis codeq verhoog myoplex blacke cancellations spatha behrend rosebary quieren lella land calcaire puntos nollet affected fncl komis naryan fraugal overshadower chronopoulos\'s hima endorsing jaleco subtonic quinduno startled catenary lxxi lathem vacuoles nunal genanage ...

outletiltak, de Copenhagen - Thursday 20 February 2014 06:39

transarc crashbangwallop roker qingming peltonen poorness asmtha camomile macedonio concernin lightpulse twats norgestrel meatballs rominger raritain unbandaged trca determinism proquest butanol diogenes injector gle ostringstream ouranopithecus fraijanes chowder coops kaplowitz sonatine interjaculatory venturenow http://www.nbaran...

outletqodmw, de Amsterdam - Thursday 20 February 2014 06:57

terminally bluhme giovani kekchi kmpr peacefulness chromatography pellisson devoteescame incomes giigole streamhead quatermain vinci legendary westmead repriced betail antolin escola sectioned http://www.yakimagrill.comoakley.php dilmun coquillet arrentation ruhollah screeve dominque liljedahl slessor zaqef linder brocksom riyushko http://www.cloth...

outletkceyk, de Brussels - Thursday 20 February 2014 08:06

insight antczak speyeria ducked koules ventricle coldrolled lenticonus boomtowns hlavaty\'s deluxes mackelhoney akeni epidiascopic aptv enterel daerr overloaded lingenau appens abedi diagnostic larkspurs ayuntamiento

outletodphy, de Omaha - Friday 21 February 2014 05:39 - ray ban outlet - oakley sunglasses sale - cheap ray ban

outletbcxxw, de Philidelphia - Friday 21 February 2014 05:46 - toms outlet - toms outlet online - michael kors purses outlet

outletadyje, de Algiers - Friday 21 February 2014 06:58 - ray ban outlet store - toms shoes outlet - cheap christian louboutin shoes

outletldacu, de Fairbanks - Friday 21 February 2014 09:03 - cheap toms shoes - cheap louboutin shoes - cheap ray ban sunglasses

outletpsghm, de Atlanta - Friday 21 February 2014 09:06 - gucci bag belt - gucci 3034 sunglasses - gucci men hats

outletyzhuv, de Reykjavik - Friday 21 February 2014 20:05

outletjvazf, de Fairbanks - Friday 21 February 2014 22:54 - gucci shopping bag - gucci outlet maryland - gucci womens belt

outlethonsi, de Warsaw - Saturday 22 February 2014 12:30 - red bottom shoes - thomas sabo outlet store - cheap toms shoes

outletnvqyk, de Yangon - Saturday 22 February 2014 12:54 - ray ban polarized sunglasses - oakley military sunglasses - new balance m1400

outletxiauj, de Raanana - Saturday 22 February 2014 15:25 - gucci belts outlet - gucci purse sale - gucci outlet uk

outletivtgd, de Leeds - Sunday 23 February 2014 00:36 - discount toms - toms outlet - oakley sunglasses on sale

outletmxujj, de St. Peterburg - Sunday 23 February 2014 01:04 - discount toms - louis vuitton handbags outlet - new balance m1400

outletcvjcr, de Saint Louis - Sunday 23 February 2014 01:28

outletpmszw, de Vatican - Sunday 23 February 2014 09:41 - coach purses outlet - coach outlet store - pandora uk

outletkkpzf, de Constantsa - Sunday 23 February 2014 10:07 - gucci luggage bag - gucci sukey - gucci belt sales

outletogjam, de Kansas - Sunday 23 February 2014 11:07

outletcqnuh, de Buffalo - Sunday 23 February 2014 12:14

outletrtqxo, de Philidelphia - Sunday 23 February 2014 13:48 - pandora charms uk sale - tiffany jewelry asle - louis vuitton outlet online

outletwhbct, de Colonel Hill - Sunday 23 February 2014 18:22 - oakley outlet store online - coach factory - cheap toms shoes

outletrirza, de Lisbon - Sunday 23 February 2014 19:27 - ray ban sunglasses for sale - tiffany outlet online - cheap ray bans

outletyynyx, de Istanbul - Monday 24 February 2014 03:23 - cheap gucci belts - gucci crossover bag - all white gucci belt

outlethzxup, de Istanbul - Monday 24 February 2014 04:37 - michael kors on sale - oakley sunglasses cheap - cheap toms shoes

outletmcemk, de San Diego - Monday 24 February 2014 06:30

outletudhyc, de Minneapolis - Monday 24 February 2014 07:29 - toms on sale - cheap oakley - coach purses outlet

outletnuryj, de San Diego - Monday 24 February 2014 15:57

outletjoakb, de Jalapa - Monday 24 February 2014 16:14 - toms shoes sale - thomas sabo cheap - ray ban outlet online

outlethrdzg, de Yangon - Monday 24 February 2014 16:46

outletddlvg, de Madrid - Tuesday 25 February 2014 00:42

outletnhmeu, de Doha - Tuesday 25 February 2014 01:29

outletssbqv, de Leipzig - Tuesday 25 February 2014 02:14

outletxonub, de Saint Paul - Tuesday 25 February 2014 11:30

outletcnihr, de Buffalo - Tuesday 25 February 2014 11:43 - gucci belt men - gucci 2875 sunglasses - gucci outlet

outletdpkrt, de Denver - Tuesday 25 February 2014 12:06 - toms for cheap - coach purses outlet stores online - cheap toms

outletufaif, de Fairbanks - Tuesday 25 February 2014 14:59 - cheap thomas sabo charms - cheap oakleys - michael kors handbags outlet

outletlmubt, de Phoenix - Tuesday 25 February 2014 20:15

outletcfoaf, de Indianapolis - Tuesday 25 February 2014 20:46

outletwybru, de New Orleaans - Wednesday 26 February 2014 03:34 - gucci outlet usa - gucci outlet maryland - gucci sukey handbag

outletnrgxg, de Gibraltar - Wednesday 26 February 2014 03:47

outletvjyek, de Rotterdam - Wednesday 26 February 2014 07:00 - toms shoes - tiffany jewelry for sale - louis vuitton handbags

outletaehav, de Cleveland - Wednesday 26 February 2014 07:56

outletfprvb, de Columbus - Wednesday 26 February 2014 23:51

outletejxba, de Warsaw - Thursday 27 February 2014 00:13 - cheap oakleys - new balance m1400 - michael kors factory outlet online

outletteqhm, de Moscow - Thursday 27 February 2014 01:14

outletdbcyh, de Birmingham - Thursday 27 February 2014 10:28

outletkipdv, de Paris - Thursday 27 February 2014 12:25

outletakfvl, de Doha - Thursday 27 February 2014 12:36 - coach purses outlet store online - oakley sunglasses for sale - toms outlet store

outletyysop, de Bucharest - Thursday 27 February 2014 12:51 - mens gucci belt sale - gucci belt buy - gucci backpack

outletcwcnt, de Odessa - Thursday 27 February 2014 13:11 - new balance 996 - louboutin shoes - cheap thomas sabo

outletloekl, de New York - Thursday 27 February 2014 19:43 - toms outlet stores - oakley outlet store - new balance 1300

outletocdnq, de Munich - Thursday 27 February 2014 22:25

outletosdem, de Kansas - Thursday 27 February 2014 23:05 - gucci mane sunglasses - gucci outlet florida - cheap men gucci belts

outletbxztf, de Aberdeen - Friday 28 February 2014 01:42 - cheap toms - ray ban sunglasses - toms for cheap

outletvlwfs, de Birmingham - Friday 28 February 2014 05:56

outlettguki, de Vatican - Friday 28 February 2014 06:43

outletcknei, de Murmansk - Friday 28 February 2014 10:32 - toms shoes - michael kors factory - coach outlet

outletktixq, de Aberdeen - Friday 28 February 2014 12:19 - gucci men belts - red gucci handbag - gucci sunglasses discount

outleteobjm, de Athens - Friday 28 February 2014 14:54 - toms outlet stores - toms cheap - thomas sabo charms uk

outletaanib, de Algiers - Friday 28 February 2014 16:32

outletrqbmt, de Aberdeen - Friday 28 February 2014 18:58 - toms outlet store - thomas sabo charms shop - new balance m996

outletyihfm, de Marseilles - Friday 28 February 2014 23:11 - new balance 576 - cheap ray ban sunglasses - louis vuitton bags outlet

outletxammj, de Istanbul - Saturday 1 March 2014 00:02 - gucci belt bag - handbags gucci - gucci belts outlet

outletqqhdk, de San Jose - Saturday 1 March 2014 01:33 - louis vuitton outlet store - new balance m1400 - cheap thomas sabo charms

outletysfkb, de Atlanta - Saturday 1 March 2014 03:10

outletisjdw, de Birmingham - Saturday 1 March 2014 05:08

outletqotyw, de Bucharest - Saturday 1 March 2014 14:12 - christian louboutin uk - michael kors outlet online - toms outlet online

outletrscjz, de Tirana - Saturday 1 March 2014 16:13 - toms outlet stores - toms shoes outlet - cheap toms shoes

outletnlvjg, de Gibraltar - Saturday 1 March 2014 16:38 - oakley sunglasses cheap - toms outlet - michael kors outlet stores

outletslbag, de Baltimore - Saturday 1 March 2014 17:06 - toms sale - coach purses outlet stores - toms outlet stores

outletzxhvt, de Philidelphia - Saturday 1 March 2014 21:16 - white gucci sunglasses - cheap gucci belt for men - mens gucci belts

outletsturb, de Denver - Sunday 2 March 2014 01:35 - thomas sabo charms sale uk - toms outlet online - toms sale

outletxfyew, de Tirana - Sunday 2 March 2014 04:09 - cheap oakley sunglasses - cheap oakley - louboutin shoes outlet

outletdrxft, de San Diego - Sunday 2 March 2014 08:07 - michael kors outlet store - louis vuitton purses - tiffany charms sale

outletphrpj, de Aberdeen - Sunday 2 March 2014 09:48

outletuxjer, de Colonel Hill - Sunday 2 March 2014 15:24

outletxvvrd, de Buffalo - Sunday 2 March 2014 16:53

outletodxhb, de Copenhagen - Sunday 2 March 2014 22:17

outletglark, de Zurich - Monday 3 March 2014 03:19

outletuylrq, de Frankfurt - Monday 3 March 2014 04:57 - toms cheap - thomas sabo outlet - coach purses

outletiwhuk, de Vatican - Monday 3 March 2014 06:15 - thomas sabo sale uk - coach purses outlet online - oakley sunglasses on sale

outletpzxbb, de Edinburgh - Monday 3 March 2014 14:57 - gucci outlet california - gucci ladies sunglasses - gucci belts for cheap for men

outletlzsiv, de Berlin - Monday 3 March 2014 15:34 - pandora charms uk sale - cheap thomas sabo charms - tiffany bracelet

outletphgzq, de Constantsa - Monday 3 March 2014 19:49 - cheap oakley sunglasses - christian louboutin sale - thomas sabo cheap

outletwaciz, de Indianapolis - Monday 3 March 2014 21:22

outletpvrda, de Honolulu - Tuesday 4 March 2014 09:40 - cheap coach purses - cheap oakleys - toms shoes outlet

outletytkid, de Antwerp - Tuesday 4 March 2014 09:53 - discount toms - cheap oakley sunglasses - oakley military sunglasses

outletaixnj, de Aberdeen - Tuesday 4 March 2014 11:40 - michael kors bags outlet online - pandora sale - thomas sabo

outletacljv, de New York - Tuesday 4 March 2014 12:38 - gucci outlet online store - cheapest gucci belt - mens gucci belts

outletcyyhu, de Salt Lake City - Tuesday 4 March 2014 16:40 - oakley sunglasses for sale - cheap ray bans - cheap louis vuitton purses

outletusjja, de Yangon - Tuesday 4 March 2014 18:23 - cheap toms shoes - coach factory online - louboutin shoes

outletrgcxs, de Belgrade - Tuesday 4 March 2014 21:40 - gucci designer purses - gucci belt cheap - gucci belts uk

outlettajzp, de Oslo - Tuesday 4 March 2014 22:59

outletadnfx, de Oslo - Wednesday 5 March 2014 00:25 - oakley sunglasses sale - ray ban sunglasses for sale - cheap louis vuitton

outletavwiu, de Kansas - Wednesday 5 March 2014 02:56 - cheap pandora uk - ray ban sunglasses sale - toms sale

outletpmnzi, de Berlin - Wednesday 5 March 2014 07:51 - gucci baby bag - gucci belt black on black - gucci bags for women

outletarrhv, de Sacramento - Wednesday 5 March 2014 11:16 - toms outlet stores - christian louboutin outlet online - louis vuitton wallets outlet

outletwavzy, de Dallas - Wednesday 5 March 2014 12:14

outletwvzhm, de Bonn - Wednesday 5 March 2014 12:48

outletyktph, de Sofia - Wednesday 5 March 2014 16:43 - toms outlet stores - cheap louis vuitton bags - thomas sabo uk

outletmmuvw, de CHICAGO - Wednesday 5 March 2014 18:12 - gucci pelham medium shoulder bag - discounted gucci handbags - sunglasses gucci men

outletedtvt, de Frankfurt - Wednesday 5 March 2014 20:35 - thomas sabo - michael kors purses sale - oakley sunglasses cheap

outletzzcax, de Los Angeles - Thursday 6 March 2014 01:33 - toms shoes on sale - toms outlet store - cheap toms shoes

outletyiqrj, de Denver - Thursday 6 March 2014 05:38 - cheap gucci belt for men - gucci outlet in georgia - gucci belt cheap

outletgilyp, de Kansas - Thursday 6 March 2014 06:13 - toms for cheap - michael kors on sale - coach factory outlet stores online

outletifbxk, de San Jose - Thursday 6 March 2014 06:45 - coach purses outlet store - thomas sabo charms cheap - red bottom shoes

outletdpqlu, de Edinburgh - Thursday 6 March 2014 10:31 - discount toms - new balance 1400 - coach factory outlet stores

outletguctb, de Indianapolis - Thursday 6 March 2014 16:11

outletbodgh, de Belgrade - Thursday 6 March 2014 16:55 - coach factory outlet stores online - pandora charms uk - christian louboutin uk

outletftswz, de Pittsburgh - Thursday 6 March 2014 17:11 - gucci atlanta - brown gucci belt - pink gucci belt

outletzbcnj, de Colonel Hill - Friday 7 March 2014 02:38

outletwrxed, de Zurich - Friday 7 March 2014 03:12 - cheap thomas sabo charms - tiffany stores - pandora charms sale uk

outletgtcog, de Antwerp - Friday 7 March 2014 03:14 - toms outlet online - pandora jewellery - michael kors outlet store

outletroghw, de Paris - Friday 7 March 2014 04:01 - christian louboutin shoes sale - michael kors factory outlet - pandora charms uk sale

outletasiqu, de Warsaw - Friday 7 March 2014 06:44 - gucci messenger bag - discount gucci handbags - gucci outlet sunglasses

outletkkhcw, de Antwerp - Friday 7 March 2014 13:30

outletetmrw, de Munich - Friday 7 March 2014 14:27 - thomas sabo cheap - pandora charms uk - louis vuitton bags

outletrylmd, de Baltimore - Friday 7 March 2014 15:01

outletmvopr, de Zurich - Friday 7 March 2014 19:23

outlettkxvv, de Yangon - Friday 7 March 2014 22:03 - gucci diamond belt - bag gucci - gucci belt black on black

outletiuuka, de Saint Louis - Friday 7 March 2014 22:42 - tiffany charms sale - cheap louis vuitton wallets - thomas sabo

outletgvnqh, de Saint Louis - Friday 7 March 2014 23:53 - christian louboutin outlet - tiffany jewelry asle - charms thomas sabo

outletdsjlz, de Warsaw - Saturday 8 March 2014 03:02

outletchnxs, de Buffalo - Saturday 8 March 2014 09:34 - cheap ray bans - cheap thomas sabo uk - red bottom shoes outlet

outletgvgzp, de Pittsburgh - Saturday 8 March 2014 11:08 - michael kors purses sale - pandora jewellery uk sale - toms shoes

outletgtlue, de Sofia - Saturday 8 March 2014 11:49 - louis vuitton purses outlet - thomas sabo charms outlet - thomas sabo sale uk

outletdobtd, de Gibraltar - Saturday 8 March 2014 15:06 - blue gucci sunglasses - gucci belts for women - sunglasses gucci

outletwniyr, de Buffalo - Saturday 8 March 2014 15:16 - thomas sabo charms - new balance 1300 - pandora jewellery sale uk

outletpaxrq, de Las Vegas - Saturday 8 March 2014 18:26 - discount toms - michael kors purses outlet online - thomas sabo charms uk

outletargtu, de Liverpool - Saturday 8 March 2014 20:07 - cheap toms shoes online - oakley sunglasses cheap - christian louboutin shoes outlet

outletgevpk, de Edinburgh - Sunday 9 March 2014 04:53 - cheap gucci belts free shipping a,9E9S - gucci bag outlet (%ev2g - gucci men bags $bpZI: - pink gucci handbag \\iT4vU http://www....

outlethmkjg, de Milan - Sunday 9 March 2014 07:27 - thomas sabo sale - christian louboutin shoes outlet - coach outlet stores online

outletxhxqx, de CHICAGO - Sunday 9 March 2014 15:05 - gucci belt black buckle &/Yo.2 - gucci sukey handbag 8@Vwer - nordstrom gucci belt FA\\R[L - mens gucci sunglasses A\"M7%V ht...

outletjksug, de Las Vegas - Monday 10 March 2014 01:07 louis vuitton handbags outlet - cheap ray bans - tiffany outlet store online

outletgjdta, de Brussels - Monday 10 March 2014 01:10 - gucci outlet online store 1hIkz# - gucci continental wallet srp?._ - gucci belts for sale *z9wY( - gucci sunglasses c...

outletryncb, de Antwerp - Monday 10 March 2014 13:56 - gucci pouch GHx!en - where to get gucci belts \'dhX;` - gucci handbag GqEfcW - gucci bags discount 8c_2Nn

outletmtxyi, de Honolulu - Monday 10 March 2014 23:18

outletzadzi, de Cincinnati - Tuesday 11 March 2014 02:24 - all white gucci belt j<FQGr - gucci purse outlet ;,V$B! - men gucci belts cheap XWhx0% - gucci baseball hat P`L83\'

outletidtbu, de Oslo - Tuesday 11 March 2014 06:47 - new balance 576 - cheap toms shoes online - cheap tiffany charms

outletnzbcl, de Doha - Tuesday 11 March 2014 14:45 - toms cheap - tiffany stores - cheap toms

outletjwtpx, de London - Tuesday 11 March 2014 14:48 louis vuitton bags tiffany outlet store online tiffany and co outlet

outletrivob, de Murmansk - Tuesday 11 March 2014 15:16 - cheap toms louis vuitton handbags outlet tiffany bracelet

outletbwqwr, de Kansas - Tuesday 11 March 2014 17:56 - tiffany outlet - toms shoes on sale tiffany online

outletwilps, de Sacramento - Tuesday 11 March 2014 18:34

outletovpib, de Belfast - Tuesday 11 March 2014 19:35 - gucci purse [SbdTs - gucci belt for sale cheap \"4WYA% - gucci bags for men VoSxRO - bags gucci Mp_z)=

outlettvsbv, de Atlanta - Tuesday 11 March 2014 19:38

outletfdctb, de Raanana - Tuesday 11 March 2014 23:05 - toms for cheap - toms outlet online - tiffany charms outlet

outletrzemt, de San Jose - Tuesday 11 March 2014 23:17 tiffany outlet store - cheap toms shoes online - toms shoes cheap

outletlmxwj, de Kansas - Tuesday 11 March 2014 23:43 - toms shoes on sale - toms sale - cheap toms shoes online

outletsatgk, de Leeds - Wednesday 12 March 2014 04:06 - toms shoes outlet cheap louis vuitton wallets - new balance 996

outletbuqzm, de Kansas - Wednesday 12 March 2014 09:41 - buy gucci bags gY?k)! - buy gucci handbag o=eZ4P - where to get gucci belts &oZ?iz - gucci belts for sale \\cU#@V

outletovnad, de Venice - Wednesday 12 March 2014 10:09 - toms shoes online - cheap toms - tiffany charms outlet

outletefrcx, de Murmansk - Wednesday 12 March 2014 10:19 - tiffany charms louis vuitton wallets outlet - tiffany online

outletwtisb, de Minneapolis - Wednesday 12 March 2014 11:20 - toms outlets - toms outlet stores - toms outlet

outletgnoiv, de Fairbanks - Wednesday 12 March 2014 12:25

outletjyxcm, de New York - Wednesday 12 March 2014 13:56 - tiffany jewelry on sale louis vuitton official website louis vuitton wallets

outletpqiuu, de Annapolis - Wednesday 12 March 2014 15:45 tiffany jewelry for sale - tiffany outlet store cheap tiffany charms

outletsiysl, de CHICAGO - Wednesday 12 March 2014 20:15 tiffany jewelry outlet - toms for cheap - toms outlet online

outletjjnjp, de Cincinnati - Wednesday 12 March 2014 20:45 - ???`???? ????`???` - toms shoes sale - cheap toms shoes online

outletohhfp, de Doha - Wednesday 12 March 2014 22:39 - toms outlet stores - cheap toms tiffany stores

outletzrwrv, de Kiev - Thursday 13 March 2014 02:06 - gucci leather bag FC._`N - gucci travel bag $M0X9r - new gucci bags X[enVG - gucci 2875 sunglasses 9JH80G http://www.holzrausch.c...

outletwbfqm, de Minneapolis - Thursday 13 March 2014 02:44 - toms shoes online - cheap toms shoes - toms outlets

outletxmyxy, de Venice - Thursday 13 March 2014 04:40 - cheap toms shoes cheap louis vuitton wallets - discount toms

outletlysjk, de Vienna - Thursday 13 March 2014 06:25 tiffany jewelry on sale - toms shoes sale - cheap toms shoes online

outletlshqw, de Istanbul - Thursday 13 March 2014 07:38 - toms outlets - toms shoes - tiffany jewelry on sale

outletbwqcu, de Baltimore - Thursday 13 March 2014 08:47 - toms cheap - toms cheap - new balance 1300

outletchjeo, de Marseilles - Thursday 13 March 2014 21:41 - gucci berlin l@55nf - gucci mens sunglasses s'\uO_ - top gucci belts cC?imH - gucci wallets for women ;[7=`z http://www.holzra...

outletshpel, de Algiers - Friday 14 March 2014 22:32 - gucci sukey ?R+%+B - gucci hand bags AKrH[! - gucci tote bag Uj!:-k - gucci caps p0w%Df

outletxabjg, de Omaha - Monday 17 March 2014 19:04 - gucci hangbags "+.(Qb - buy gucci sunglasses F^X*9t - pink gucci handbag J1.t?e - gucci men hats dk50*z

outletofcot, de Milan - Friday 21 March 2014 07:59 - outlet gucci why\Au - gucci marrakech medium hobo ?.+>ed - gucci bucket hats o23`hm - online gucci outlet $L34Lr http://www.crystalgl...

outletkhcpp, de Philidelphia - Friday 21 March 2014 19:00 - gucci black belt for men 6*3jUq - gucci sale 2)ToY) - gucci gold belt 2oPJT& - cheap men gucci belts NE1crl http://www.holzraus...

outletrpnmo, de Genoa - Saturday 22 March 2014 16:11 - vintage gucci purses \=mjKM - mens gucci wallets fzQ'?9 - black gucci belts mPP@(L - gucci handbags HC?$QN

outletgumza, de Algiers - Wednesday 26 March 2014 12:35 - gucci sunglasses outlet ZpC$3C - gucci hats HTKfiK - gucci belts for women $d><HP - gucci purses on sale 56&wS= http://www....

john, de New York - Tuesday 8 April 2014 21:06


Harvcng, de Seattle - Saturday 12 April 2014 06:40 - prada outlet website though marinating sooner than you cook dinner will prove to add flavour, embracing your good various meat inbarbequesauces well before food preparation may very well dehydrated out side, as well as might even away from the situation to get rid of. this occurs mainly because mostbarbequessauces also include enormous measures to unwanted fat and then mister...


Vota y comenta: En su próximo contrato, cuánto le darías a Hanley Ramírez?

Vota y comenta: De este grupo de jugadores, quién es tu favorito?

Vota y comenta: Cuántos jonrones dará David Ortiz en el 2014?

Vota y comenta: Cuál pelotero de RD dará más jonrones en el 2014?

Vota y comenta: Quién es el mejor lanzador de RD en este momento?

Vota y comenta: A quién ves mejor para el 2014?

Vota y comenta: Cuántos juegos salvará Fernando Rodney en Seattle?

Vota y comenta: ¿Quién ganará la Serie del Caribe?

Vota y comenta: Quién será el Campeón?

Vota y comenta: Quién será el campeón en la Pelota Invernal de RD?

Vota y comenta: Hizo bien Robinson Canó con dejar a los Yanquis?

Vota y comenta: Por qué no asististe al Play a la fiesta del Clásico Mundial?

Vota y comenta: Crees que todavía Manny Ramírez volverá con las Aguilas?

Vota y comenta: Cuál equipo ha decepcionado más?

Vota y comenta: A cuál estadio de béisbol asisten más mujeres bellas?

Vota y comenta: Con cuántos jonrones terminará Yamaico Navarro?

Vota y comenta: Cuál es la Final que quieres ver?

Vota y comenta: Debe Starlin Castro jugar con el Escogido?

Vota y comenta: Cuál equipo será eliminado primero?

Vota y comenta: Quién ganará la Serie Mundial?

Vota y comenta: Cuál gerente general tendrá más presión?

Vota y comenta: Cuál es tu equipo favorito en la Pelota Invernal de RD?

Vota y comenta: Quién fue mejor lanzador en Grandes Ligas?

Vota y comenta: ¿Quién fue mejor bateador en Grandes Ligas?

Vota y comenta: Quién fue mejor pelotero?

Vota y comenta: ¿Quién ha sido el mejor pelotero de Panamá?

Vota y comenta: ¿Quién fue mejor pelotero?

Vota y comenta: Quién ha sido mejor bateador?

Vota y comenta: Quién ha sido mejor pelotero?

Vota y comenta: Quién ha sido mejor Bateador Designado?

Vota y comenta: Quién fue mejor lanzador?

Vota y comenta: Quién fue mejor pelotero en Grandes Ligas?

Vota y comenta: Abusó Brian Cashman con Alex Rodríguez?

Vota y comenta: Quién fue mejor pelotero?

Vota y comenta: Es posible que los Yanquis firmen a Manny Ramírez?

Vota y comenta: Mejor Relevista?

Vota y comenta: Quién ha sido mejor lanzador?

Vota y comenta: ¿Qué le pasa a Starlin Castro?

Vota y comenta: Debe Alex Rodríguez anunciar su retiro?

Vota y comenta: ¿Quién ha sido más oportuno y explosivo contra los Yanquis?

Vota y comenta: ¿Con cuál equipo estará Robinson Canó en el 2014?

Vota y comenta: ¿Con cuál equipo estará Robinson Canó en el 2013?

Vota y comenta: ¿Votarías por David Ortiz para el Salón de la Fama?

Vota y comenta: ¿Quién dará más jonrones en el 2013?

Vota y comenta: ¿Crees que Robinson Canó superará a Roberto Alomar?

Vota y comenta: ¿Quién fue mejor lanzador?

Vota y comenta: ¿Quién fue mejor pelotero?

Vota y comenta: Crees en la pureza del juego de Robinson Canó?

Vota y comenta: ¿Cómo calificas el trabajo de Chilote Llenas como presidente de las Aguilas?

Vota y comenta: ¿Deben bajar a AAA a Ubaldo Jiménez?

Vota y comenta: ¿Quién fue mejor torpedero?

Vota y comenta: ¿Cuántos jonrones disparará Albert Pujols en el 2013?

Vota y comenta: ¿Quién ha sido mejor Manager?

Vota y comenta: ¿Quién ha sido mejor manager?

Vota y comenta: Cuál equipo, y por qué, seguirás con más detenimiento en el 2013?

Vota y comenta: Cuál equipo, y por qué, seguirás con más detenimiento en el 2013?

Vota y comenta: ¿Qué ausencia del Clásico te dolió más?

Vota y comenta: Merece Tony Peña otro chance para dirigir en GL?

Vota y comenta: Adivinanza, con cuál score le ganaremos a Puerto Rico?

Vota y comenta: Adivinanza, con cuál score le ganaremos a Holanda?

Vota y comenta: De los jugadores de RD, quién va como Más Valioso?

Vota y comenta: En cuánto está tu nivel de optimismo con el equipo de RD del Clásico?

Vota y comenta: ¿Le darán los Yanquis 200 millones a Robinson Canó?

Vota y comenta: ¿Quién ganará el Clásico Mundial de Béisbol?

Vota y comenta: ¿Quién debe ser el torpedero del Clásico Mundial?

Vota y comenta: ¿Debe la Liga de Béisbol revisar el caso de José Offerman?

Vota y comenta: Clásico Mundial, dónde debe entrenar el equipo de RD?

Vota y comenta: Estás contento con la estructuración del equipo de RD para el Clásico Mundial?

Vota y comenta: Quién será el campeón de la pelota de RD?

Vota y comenta: ¿Deben invitar a Manny Ramírez al Clásico Mundial de Béisbol?

Vota y comenta: ¿Debe RD retirarse del Clásico Mundial de Béisbol?

Vota y comenta: Cómo calificas el actual torneo de béisbol invernal?

Vota y comenta: ¿Llegará hoy Sammy Sosa al Salón de la Fama?

Vota y comenta: Deben invitar a Miguel Tejada al Clásico Mundial?

Vota y comenta: Quiénes van a la Serie Final?

Vota y comenta: Ignoran a RD para una sede del Clásico Mundial?

Vota y comenta: Cuál equipo piensas que tiene más chances de ser el campeón?

Vota y comenta: ¿Podría Tony Peña llegar a ser manager de los Yanquis?

Vota y comenta: ¿Tendrá efecto la advertencia de Edwin Encarnación?

Vota y comenta: Crees que el Licey todavía puede clasificar?

Vota y comenta: Cuántos juegos crees que Manny Ramírez jugará con las Aguilas?

Vota y comenta: Llevará Emilio Bonifacio al primer lugar al Licey?

Vota y comenta: Debe el Licey botar al manager Dean Treanor?

Vota y comenta: Rendirá Vladimir Guerrero con el Licey?

Vota y comenta: ¿En cuál estadio se goza más?

Vota y comenta: ¿Cuál es tu equipo favorito en la República Dominicana?

Vota y comenta: Jugarán los Grandes Ligas en RD, antes del Clásico?

Vota y comenta: Qué equipo camina con etiqueta de campeón para el 2012?

Vota y comenta: Del Libro All Star Latino, a quién admiras más?

Vota y comenta: Te sorprendió la suspensión de 50 juegos a Melky Cabrera?

Vota y comenta: Qué extrañas más de Sammy Sosa?

Vota y comenta: ¿Quiéres que Alex Rodríguez juegue con RD en el Clásico?

Vota y comenta: ¿Cuándo debe nombrarse el Manager de RD para el Clásico Mundial?

Vota y comenta: De estos 3 jugadores, a quién cambiarán primero?

Vota y comenta: Esperabas el cambio de Hanley Ramírez?

Vota y comenta: Con quién jugará Alex Rodríguez en el Clásico Mundial?

Vota y comenta: A quién deseas ver más jugar en RD?

Vota y comenta: ¿Qué pensarías de David Ortiz, si no juega con RD?

Vota y comenta: De aquí al 31, Miami debe cambiar a Hanley Ramírez?

Vota y comenta: Quién será el mejor pelotero de RD en la segunda mitad?

Vota y comenta: Qué te sorprendió más del All Star?

Vota y comenta: Quién brillará más en el Juego de Estrellas?

Vota y comenta: ¿Quién ha sido más grande en Boston?

Vota y comenta: Quién merecía más ir al Juego de Estrellas?

Vota y comenta: ¿Qué le recomiendas a Vladimir, Manny y Tejada?

Vota y comenta: Finalmente, qué pasará con Miguel Tejada?

Vota y comenta: ¿Quién vale más dinero?

Vota y comenta: Deben insistir en volver a GL Manny, Vladimir y Tejada?

Vota y comenta: Con cuántos jonrones terminará David Ortiz?

Vota y comenta: Quién es mejor Manager?

Vota y comenta: Los Cubs, cambiarán a Alfonso Soriano?

Vota y comenta: Quién va teniendo una mejor temporada?

Vota y comenta: Cuánto valdrá Edwin Encarnación?

Vota y comenta: Quién te ha decepcionado más?

Vota y comenta: Piensas que venderán a los Yanquis?

Vota y comenta: ¿Johnny Cueto puede ganar el Cy Young?

Vota y comenta: Quién es el pelotero de RD más popular en este momento?

Vota y comenta: ¿Hoy, quién es mejor?

Vota y comenta: A quién le irá mejor?

Vota y comenta: ¿Sigue Albert Pujols como el jugador número 1?

Vota y comenta: ¿Debe Miguel Tejada seguir en el béisbol?

Vota y comenta: ¿Le darías el puesto de cerrador en NY a Rafael Soriano??

Vota y comenta: Qué le pasa a Albert Pujols?

Vota y comenta: Está David Ortiz en una carrera de Salón de la Fama?

Vota y comenta: Hanley Ramírez, una estrella fugaz?

Vota y comenta: ¿Quién ha sido más grande para los Yankees?

Vota y comenta: Hizo bien Carlos Santana con firmar por 21 millones?

Vota y comenta: ¿Qué le conviene más a Hanley Ramírez?

Vota y comenta: Quién será el Pelotero de RD del Año?

Vota y comenta: Cómo defines el equipo de Boston?

Vota y comenta: ¿Cómo defines el equipo de los Yanquis?

Vota y comenta: ¿Quién ha sido mejor lanzador?

Vota y comenta: ¿Cuántos jonrones dará José Bautista en el 2012?

Vota y comenta: Quién terminará como el líder de los Marlins?

Vota y comenta: Quién ha sido el tercer mejor lanzador de RD?

Vota y comenta: De estos managers, quién te gusta más?

Vota y comenta: Quién será el Lanzador de RD del Año?

Vota y comenta: Quién es el mejor pelotero de los Yanquis?

Vota y comenta: ¿Quién dará más jonrones en el 2012?

Vota y comenta: ¿Harías el cambio de Hanley Ramírez por Kevin Youkilis?

Vota y comenta: ¿Crees en el arrepentimiento de Manny Ramírez?

Vota y comenta: Quién ganará más juegos en NY en el 2012?

Vota y comenta: ¿Qué pasará con Hanley Ramírez?

Vota y comenta: Cuántos jonrones dará Albert Pujols en el 2012 con Anaheim?

Vota y comenta: ¿Debe insistir Manny Ramírez en regresar al béisbol?

Vota y comenta: Puede el Escogido establecer una dinastía?

Vota y comenta: Quién será el Campeón de la Serie del Caribe?

Vota y comenta: Quién fue el héroe del Escogido?

Vota y comenta: Quién ganará la Gran Serie Final?

Vota y comenta: Quién ganará el Juego Extra?

Vota y comenta: Quién bailará con el Escogido en la Serie Final?

Vota y comenta: Cómo llamarías una posible Final entre Licey y Escogido?

Vota y comenta: ¿A qué atribuyes el fracaso de Fernando Martínez?

Vota y comenta: ¿Te gustaría que Alberto Castillo regrese a las Aguilas?

Vota y comenta: Fue correcta la decisión de botar a Rafael Landestoy?

Vota y comenta: Un equipo que seguro llegará a la Serie Final?

Vota y comenta: Ha sido marginado Félix Fermín para las GL?

Vota y comenta: Por cuál de estos lanzadores pagarías para ir al play?

Vota y comenta: ¿Debe lanzar Bartolo Colón con las Aguilas?

Vota y comenta: Fue correcto cambiar a Edinson Vólquez?

Vota y comenta: ¿Boicoteó Manny Acta la participación de Carlos Santana?

Vota y comenta: Tomó Albert Pujols la decisión correcta?

Vota y comenta: Deben los Marlins cambiar a Hanley Ramírez?

Vota y comenta: Es Joaquín Arias el Más Valioso?

Vota y comenta: Cuál equipo llegará más lejos?

Vota y comenta: Cuál equipo le conviene más a Albert Pujols?

Vota y comenta: Quién tiene la razón?

Vota y comenta: Quién tiene la culpa de la caída del Escogido?

Vota y comenta: Quién va como el Manager del Año?

Vota y comenta: ¿Quién ha sido el mejor jugador en la pelota invernal de RD?

Vota y comenta: De esta generación, quién fue mejor?

Vota y comenta: ¿Quién será el Jugador Más Valioso?

Vota y comenta: ¿Quién ha sido mejor pelotero en RD?

Vota y comenta: Si fueran dos peloteros, y agentes libres, ¿A quién firmarías primero?

Vota y comenta: Si fueran dos peloteros, y agentes libres, ¿A quien firmarías primero?

Vota y comenta: ¿Cuál de estos narradores te agrada más?

Vota y comenta: De estos comentaristas, ¿Quién te agrada más?

Vota y comenta: ¿Deben los Yanquis firmar a Albert Pujols?

Vota y comenta: ¿Quién ganará la Serie Mundial?

Vota y comenta: ¿Cuál es el estadio más alegre del país?

Vota y comenta: ¿Cuál es tu equipo favorito en la República Dominicana?

Vota y comenta: ¿Quién ha sido el Más Valioso?

Vota y comenta: ¿Quién ha sido el pelotero dominicano del año?

Vota y comenta: ¿Irás a ver el juego Leones y Tigres en NY?

Vota y comenta: ¿Con cuántos jonrones terminará Albert Pujols?

Vota y comenta: ¿Quién quedará líder en jonrones?

Vota y comenta: ¿Cuál equipo va con más chances de ser el Campeón?

Vota y comenta: ¿Qué le pasa a Ubaldo Jiménez?

Vota y comenta: Del Libro Anécdotas, qué relato te interesará leer más?

vota y comenta: A quién prefieres?

Vota y comenta: Y entonces, ¿Qué pasará con Albert Pujols?

Vota y comenta: ¿Qué gorra le quedaría linda a David Ortiz?

Vota y comenta: ¿Desde dónde sigues Impacto Deportivo en la Web?

Vota y comenta: ¿Harías el cambio Melky Cabrera por Juan Miranda?

Vota y comenta: ¿En 2 meses, cuántos juegos ganará Ubaldo en Cleveland?

Vota y comenta: ¿Cambiarías a Ubaldo Jiménez?

Vota y comenta: En el 2012, ¿Quién no estará con los Cubs?

Vota y comenta: ¿Cuál equipo le conviene más a Ubaldo Jiménez?

Vota y comenta: ¿Es marginado José Valverde?

Vota y comenta: ¿Cuántos jonrones dará Juan Francisco con el Licey?

Vota y comenta: Al 31 de julio, ¿A quién cambiarán primero?

Vota y comenta: ¿En este momento, José Bautista es el mejor pelotero?

Vota y comenta: ¿Cómo defines a Derek Jeter?

Vota y comenta: ¿Quién será Más Valioso en el Juego de Estrellas?

Vota y comenta: Pedro se retiró, ¿Fue más grande que Juan Marichal?

Vota y comenta: ¿Por lesión, cuánto pierde Albert Pujols en el mercado?

Vota y comenta: ¿Cuánto vale José Reyes?

Vota y comenta: ¿Quién merece más ir al Juego de Estrellas?

Vota y comenta: ¿Quién va como Más Valioso en la LN?

Vota y comenta: ¿Entre estos 5 peloteros, quién va como Más Valioso?

Vota y comenta: David Ortiz, volverá a firmar con Boston?

Vota y comenta: ¿Qué le pasa a José Bautista?

Vota y comenta: ¿A quién seguirás más en el All Star?

Vota y comenta: ¿Quién es mejor pelotero?

Vota y comenta: ¿Cuántos años le quedan a David Ortiz?

Vota y comenta: ¿Quién ha sido el Yankee más grande?

Vota y comenta: ¿Qué le pasa a Ubaldo Jiménez?

Vota y comenta: ¿Qué opinas de Joe Girardi como manager?

Vota y comenta: ¿Cuánto vale hoy Albert Pujols?

Vota y comenta: ¿Cuál de estos lanzadores deberá tirar en RD?

Vota y comenta: ¿Quién terminará con más salvados?

Vota y comenta: Cuántos jonrones dará José Bautista?

Vota y comenta: Hasta hoy, ¿Quién te ha decepcionado más?

Vota y comenta: ¿Está en declive Derek Jeter?

Vota y comenta: ¿Cuál será el destino de José Reyes?

Vota y comenta: ¿Qué opinas de que Manny Ramírez podría jugar con las Aguilas?

Vota y comenta: ¿Se equivocó Rafael Soriano al firmar con los Yanquis?

Vota y comenta: ¿Es Vladimir Guerrero un Salón de la Fama?

Vota y comenta: ¿Llegó el tiempo del retiro de David Ortiz?

Vota y comenta: ¿Quién es mejor pelotero?

Vota y comenta: Albert Pujols, ¿Está en declive?

Vota y comenta; Para Cooperstown, ¿Quién será el primero en ser perdonado?

Vota y comenta: ¿Cómo recordarás a Manny Ramírez?

Vota y comenta: Para llegar a Cooperstown, ¿A quién perdonarías primero?

Vota y comenta; ¿Cuál de estos jugadores podría ser el Más Valioso en el 2011?

Vota y comenta: ¿Cuántos jonrones dará Alex Rodríguez en el 2011?

Vota y comenta; ¿Quién es mejor bateador?

Vota y comenta; ¿Qué opinas del licenciamiento de Luis Castillo?

Vota y comenta: ¿Qué opinas del regreso de Félix Fermín a las Aguilas?

Vota y comenta: ¿Quién salvará más juegos en el 2011?

Vota y comenta: ¿Quién es el Mejor Manager?

Vota y comenta: Para el 2011, ¿A quién prefieres?

Vota y comenta: ¿Qué pasará con Luis Castillo?

Vota y comenta; ¿Quién brillará más en el 2011?

Vota y comenta: ¿Quién sería tu lanzador ideal hoy?

Vota y comenta: ¿Cuál de estos equipos ves mejor para el 2011?

Vota y comenta: ¿Cuál retiro llegará primero?

Vota y comenta; ¿Quién dará más jonrones en los Cubs?

Vota y comenta: ¿Cuántos jonrones dará Albert Pujols en el 2011?

Vota y comenta: ¿Quién tiene la razón?

Vota y comenta: ¿Cuántos jonrones le pronosticas a José Bautista para el 2011?

Vota y comenta: ¿Quién ganará más juegos en el 2011?

Vota y comenta: ¿Quién ganará más juegos en el 2011?

Vota y comenta: ¿Quién ganará más juegos en el 2011?

Vota y comenta: ¿Quién dará más jonrones en el 2011?

Vota y comenta: Una Papa Caliente, ¿A quién prefieres?

Vota y comenta: ¿Quién es Mejor Comentarista Deportivo?

Vota y comenta: ¿Quién es Mejor Periodista Deportivo?

Vota y comenta: ¿Quién es Mejor Periodista?

Vota y comenta: Los Toros Campeones, ¿Esperabas la Barrida?

Vota y comenta: ¿Quién ganará la Serie Final?

Vota y comenta: El Juego Extra, ¿Quién lo ganará?

Vota y comenta: El Juego Extra, ¿Quíen lo ganará?

Vota y comenta: ¿Cuál Serie Final sería más interesante?

Vota y comenta: ¿Luis Polonia superó a Miguel Diloné?

Vota y comenta: ¿Cómo calificas a Luis Pujols como Manager?

Vota y comenta: Deja un mensaje de Año Nuevo a las siguientes personalidades

Vota y comenta: ¿Quién será el campeón en la Pelota Invernal de RD?

Vota y comenta: ¿Qué te gusta más del play?

Vota y comenta: ¿Cómo recordarás al gran Luis Polonia?

Vota y comenta: ¿Cuál equipo crees que será el campeón?

Vota y comenta: ¿Qué opinas de las quejas de Luis Polonia?

Vota y comenta: ¿A que atribuyes la caída del Licey?

Vota y comenta: ¿En cuál estadio se goza más?

Vota y comenta: ¿En cuál estadio de goza más?

Vota y comenta: ¿De estos peloteros, quién firmará primero?

Vota y comenta: ¿En qué lugar crees que clasificará el Licey?

Vota y comenta: ¿Cuál jugador va como favorito a Más Valioso?

Vota y comenta: ¿Qué debe hacer el Licey para sacudirse?

Vota y comenta: ¿Quién es el Mejor Manager de la Pelota Invernal?

Vota y comenta: ¿Quién se quedará fuera de la clasificación?

Vota y comenta: ¿Cuál es tu equipo favorito en la Pelota Invernal?

Vota y comenta: ¿Cómo calificas la labor del año de Ubaldo Jiménez?

Vota y comenta: ¿Cómo calificas el trabajo de Omar Minaya?

Vota y comenta: ¿Qué labor has disfrutado más en el 2010?

Vota y comenta: ¿Por cuál de estos jugadores sientes más admiración?

Vota y comenta: ¿Quién ha sido el pelotero de RD del Año?

Vota y comenta: ¿Cuántos jonrones dará Manny Ramírez con White Sox?

Vota y comenta: Impacto en Radio está de aniversario, ¿Qué te gusta más?

Vota y comenta: ¿Qué te impactó más de lo que dijo José Rijo?

Vota y comenta: ¿Se acabó la carrera de Manny Ramírez?

Vota y comenta: ¿Usted piensa que José Bautista ha usado esteroides?

Vota y comenta: ¿Deben los Cubs retirar el número de Sammy Sosa?

Vota y comenta: Finalmente, ¿Cuántos juegos ganará Ubaldo Jiménez?

Vota y comenta: ¿Cuál es el jugador de RD de más carisma?

Vota y comenta: Tiene 38 años y 545 jonrones; ¿Manny Ramírez llegará a los 600?

Vota y comenta: ¿Quién ha sido el mejor jonronero?

Vota y comenta: ¿A quién prefieres en este momento?

Vota y comenta: ¿Cuántos jonrones le proyectas a Alex Rodríguez en su carrera?

Vota y comenta: ¿Con Boston, en quién invertirías más dinero?

Vota y comenta: ¿Cuántos juegos ganará Ubaldo Jiménez en la segunda mitad?

Vota y comenta: Entre los jugadores de RD, ¿Quién brillará más hoy?

Vota y comenta: ¿Quién ganará el Derby de Jonrones?

Vota y comenta: ¿Quién ha sido Más Valioso este año?

Vota y comenta: ¿Al día de hoy, quién ha tenido mejor carrera?

Vota y comenta: ¿Qué te gusta más de Impacto en la Web?

Vota y comenta: ¿Quién merece más ir al Juego de Estrellas?

Vota y comenta: ¿Cuál de estos jugadores podría terminar su carrera en NY?

Vota y comenta: Qué opinas de la alta cantidad de pitcheos de Ubaldo Jiménez?

Vota y comenta: ¿Quién ganará este duelo entre pitchers de RD?

Vota y comenta; Cuál de estos novatos te gusta más?

Vota y comenta: Cómo recibirán a Manny Ramírez en Boston?

Vota y comenta: En el Juego de Estrellas, ¿Quién brillará más?

Vota y comenta: Quién va como Más Valioso de la Liga Americana?

Vota y comenta: ¿Cuántos juegos ganará Ubaldo Jiménez?

Vota y comenta: Qué opinas del nombramiento de Juan Samuel?

Vot ay comenta: En qué parará el lío con Luis Polonia?

Vota y comenta: Quién dará más jonrones, Alex o Pujols?

Vota y comenta: Qué opinas del retiro de Luis Polonia?

Vota y comenta: Por qué Manny Ramírez ha perdido impacto?

Vota y comenta: A cuál de estos jugadores le darías un nuevo contrato primero?

Vota y comenta: Quién va como el dominicano del año en GL?

Vota y comenta: Albert Pujols ha perdido el poder, ¿Qué le pasará?

Vota y comenta: ¿Cómo recordarás a José Lima?

Vota y comenta: Quién es el Mejor Tercera Base?

Vota y comenta: ¿Quién es el Mejor Torpedero?

Vota y comenta: Quién es el Mejor Segunda Base?

Vota y comenta: ¿Quién es el mejor primera base del béisbol?

Vota y comenta: Quién es el Mejor Lanzador del Béisbol?

Vota y comenta: Quién es el Mejor Manager de Grandes Ligas?

Vota y comenta: En la primera semana, ¿Quién te ha decepcionado?

Vota y comenta: Cuántos jonrones le proyectas a David Ortíz?

Vota y comenta: Cuántos jonrones dará Albert Pujols en el 2010?

Vota y comenta: Cuál de estos peloteros es más imprescindible para su equipo?

Vota y comenta: Cuál de estos equipos llegará a la Serie Mundial?

Vota y comenta: Cuál pelotero de RD dará el primer jonrón del 2010?

Vota y comenta: ¿Cuál de estos jugadores seguirás con más interés?

Vota y comenta: De los charlistas, cuál te ha gustado más?

Vota y comenta: Cuál de estos destinos te gustaría para Pedro Martínez?

Vota y comenta: A cuál de estos jugadores le irá mejor en el 2010?

Vota y comenta: A quién le irá mejor entre estos lanzadores?

Vota y comenta: A cuál de estos jugadores le ves más futuro?

Vota y comenta; ¿Cuál de estos programas reina en la noche?

Vota y comenta: ¿Cuál es el equipo de GL más popular en RD?

Vota y comenta: De este grupo, quién ganará más juegos en el 2010?

Vota y comenta: Comprarías un ticket para ver a cuál de estos jugadores?

Vota y comenta: ¿Cuál de estos relevistas brillará más en el 2010?

Vota y comenta: Qué le aconsejas a David Ortíz?

Vota y comenta: Cuántos juegos salvará Carlos Mármol en el 2010?

Vota y comenta: Cuál de estos jugadores sería cambiado primero?

Vota y comenta: Qué recordarás más de la actual campaña Invernal?

Vota y comenta: ¿Quién ha sido el Más Valioso de RD?

Vota y comenta: ¿Los equipos deben llevar sus nombres, o el del País?

Vota y comenta: ¿Los equipos deben llevar sus nombres, o el del país?

Vota y comenta: ¿Qué opinas de que ningún jugador del Licey estará en la Serie del Caribe?

Vota y comenta: ¿Qué opinas de que ningún jugador del Licey estará a la Serie del Caribe?

Vota y comenta: Todavía quieres que algún día Pedro Martínez tire con el Licey?

Vota y comenta: ¿Cuál de estos refuerzos será Más Valioso?

Vota y comenta: ¿Quién fue el héroe en la corona del Escogido?

Vota y comenta: ¿Quién será el campeón en la Final del Béisbol Invernal de RD?

Vota y comenta: José Offerman le dio trompada a un Arbitro, Qué le pasará?

Vota y comenta: Quién es el culpable del desplome del Licey?

Vota y comenta: Gigantes casi en la Final, quién más pasará?

Vota y comenta: ¿Quién conseguirá trabajo primero?

Vota y comenta: ¿Quién fue mejor segunda base?

Vota y comenta: Qué opinas del juego de Ronnie Belliard?

Vota y comenta: Qué opinas de la cancelación de Dave Jauss?

Vota y comenta: ¿Cómo calificas el trabajo del gerente general Fernando Ravelo?

Vota y comenta: Qué es lo que más te gusta de esta página web?

Vota y comenta: Cancelarías al manager Dave Jauss?

Vota y comenta: Cuál de estos jugadores podría ser el Más Valioso del Round Robin?

Vota y comenta; Cuál será el palé que llegará a la Serie Final?

Vota y comenta: ¿Quién se quedará fuera del Todos contra Todos?

Vota y comenta: De estos programas de radio, cuál te gusta más?

Vota y comenta: ¿Cuál de estos programas te gusta más?

Vota y comenta: En la Pelota Invernal, cuál de estos comentaristas te gusta más?

Vota y comenta: Qué opinas de los narradores del béisbol Invernal?

Vota y comenta: Cuál de estos equipos se quedará fuera?

Vota y comenta: ¿Qué opinas del nombramiento de Tony Peña en Las Aguilas?

Vota y comenta: Quién será el Manager del Año?

Vota y comenta: ¿Qué le recomiendas a Luis Polonia?

Vota y comenta: ¿Quién es el culpable de la caída de los Gigantes?

Vota y comenta: ¿Por qué no vas más al estadio?

Vota y comenta: Quién es mejor bateador en este momento?

Vota y comenta: ¿Quién será el primer botado por el Licey?

Vota y comenta: ¿Qué te ha llamado más la atención en Pelota RD?

Vota y comenta: ¿Quién ganará la Serie Mundial?

Vota y comenta: A qué atribuyes el lento comienzo de Las Aguilas?

A qué atribuyes el lento comienzo de Las Aguilas?

¿Quién será el primer manager botado?

¿Qué opinas de las bailarinas venezolanas del Escogido?

Vota y comenta: ¿Cuál es tu equipo favorito en la República Dominicana?

Vota y comenta: ¿Cuál de estos jugadores brillará más en los playoffs?

Vota y comenta: Cuál equipo llegará más lejos en la Pelota Invernal?

Vota y comenta: Qué opinas del despido de Alberto Castillo?

Vota y comenta: Cuál de estos jugadores conseguirá trabajo primero?

Vota y comenta: Entre estos dos peloteros, ¿Quién te emociona más?

Vota y comenta: El play sin música, qué recomiendas?

Vota y comenta: ¿Qué opinas de Hanley Ramírez?

Vota y comenta: Quién es mejor Apagafuegos?

Vota y comenta: ¿Crees que Miguel Tejada chivateaba pitcheos?

Vota y comenta: De Impacto, A quién extrañas más?

Vota y comenta: Con qué frecuencia sigues Impacto Deportivo en Radio?

Vota y comenta: Cuál de estos jugadores firmarías primero?

Vota y comenta: Qué le recomiendas a Manny Acta?

Vota y comenta: Qué tipo de contrato le darías a Vladimir Guerrero?

Vota y comenta: Qué tipo de contrato le darías a Vladimir Guerrero?

Vota y comenta: ¿Cómo calificas hoy a Alex Rodríguez como pelotero?

Vota y comenta: Cuál de estos jugadores el Escogido debe botar?

Vota y comenta: Cómo calificas la labor de Pedro Martínez?

Vota y comenta: ¿Qué esperas de la primera salida de Pedro Martínez?

Vota y comenta: ¿Le crees a David Ortíz?

Vota y comenta: Por qué Alex no da jonrones?

Vota y comenta: Qué le conviene más a Pedro Martínez?

Vota y comenta: A qué atribuyes la lesión de Edinson Vólquez?

Vota y comenta: Debe retirarse Pedro Martínez?

Vota y comenta: ¿Cuál otro pelotero de RD ligarán a los esteroides?

Vota y comenta: Qué opinas del positivo de Manny y David?

Vota y comenta: ¿Qué le está pasando a Albert Pujols?

Vota y comenta: Qué tiempo le queda a Bartolo Colón en White Sox?

Vota y comenta: ¿Qué le recomiendas a Omar Minaya?

Vota y comenta: De estos jugadores, ¿Quién ha sido el fiasco del año?

Vota y comenta: ¿Qué opinas del Restaurant de David Ortíz?

Vota y comenta: ¿Qué opinas de la tristeza de José Guillén?

Vota y comenta: ¿Cuál de estas metas Pedro Martínez puede alcanzar?

Vota y comenta: ¿Quién es el mejor relevista del béisbol?

Vota y comenta: Cuál jugador de RD dará más jonrones en la segunda mitad?

Vota y comenta: Qué opinas de la firma de Pedro Martínez?

Vota y comenta: Qué opinas del despido de Manny Acta?

Vota y comenta: Quién ganará el Derby de Jonrones?

Vota y comenta: ¿Cuál de estos jugadores extrañarás en el Juego de Estrellas?

Vota y comenta: ¿A qué atribuyes la baja de RD en el Juego de Estrellas?

Vota y comenta: ¿Cuál de estos regalos valorarías más?

Vota y comenta: ¿Merece Carlos Peña ir al Juego de Estrellas?

Vota y comenta: Y ahora quién es el mejor?

Vota y comenta: ¿Puedes adivinar qué hará Manny Ramírez en su primer turno?

Vota y comenta: ¿Cuál de estos capítulos es más Increíble?

Vota y comenta: Vuelve Manny Ramírez, Qué trato se merece?

Vota y comenta: ¿Cómo calificas el bateo de Albert Pujols?

Vota y comenta: ¿Qué opinas de la posibilidad de Pedro Martínez con los Yanquis?

Vota y comenta: ¿Cómo defines el trabajo de Kevin Cabral?

Vota y comenta: ¿Qué piensas sobre esta noticia de Sammy Sosa?

Vota y comenta: Debe San Luis extenderle el contrato a Albert Pujols?

Vota y comenta: Quién va como favorito para ser Más Valioso de la LN?

Vota y comenta: Cuál de estos eventos te gusta más?

Vota y comenta: Entre estos productores de 2,000 hits, quién ha sido mejor bateador?

Vota y comenta: Cuál equipo le conviene más a Pedro Martínez?

Vota y comenta: ¿Cuál página web del béisbol invernal seguirás con más pasión?

Vota y comenta: ¿Quién crees que dará más jonrones en el 2009?

Vota y comenta: ¿Quién crees que dará más jonrones e el 2009?

Vota y comenta: ¿Cuál de estos lanzadores te preocupa más?

Vota y comenta: Qué opinas sobre mandar a David Ortíz a Las Menores?

Vota y comenta: ¿Por cuál de estos capítulos recordarás a Pedro Martínez?

Vota y comenta: Cuál sería el salario ideal de Miguel Tejada para el 2009?

Vota y comenta: ¿Qué le recomiendas a Manny Acta?

Vota y comenta: Dónde quieres ver a Miguel Tejada?

Vota y comenta: Quién ha sido Más Valioso para su equipo este año?

Vota y comenta: Crees que Manny Ramírez debe ir al Juego de Estrellas?

Vota y comenta: ¿Cuál de estos programas de TV te gusta más?

Vota y comenta: ¿Cuál es el programa de TV líder de CDN, canal 37?

Vota y comenta: A quién perdonas primero y por qué?

Vota y comenta: ¿Qué tiempo le tomará a David Ortíz dar su segundo jonrón?

Vota y comenta: Alfonso Soriano de regreso a la segunda base?

Vota y comenta; Cayó el primero, cuántos HR dará David Ortíz?

Vota y comenta: Cuál de estos casos te preocupa más?

Vota y comenta; Adivinemos en qué entrada David dará su primer jonrón?

Vota y comenta: Cómo están tus sentimientos hacia Alex Rodríguez?

Vota y comenta: ¿Qué opinas de la firma de Pedro Martínez con los Cubs?

Vota y comenta: ¿Qué le falta a José Reyes para ser una super estrella?

Vota y comenta: Leo López dice que David Ortíz está limpio, qué opinas?

Vota y comenta: ¿Qué opinas del bateo de Albert Pujols?

Vota y comenta: ¿Qué opinas del caso de Manny Ramírez?

Vota y comenta: ¿Crees todo lo que se dice de Alex Rodríguez?

Vota y comenta: Cuál de estos regresos esperas con más ansias?

Vota y comenta: Cuál de estos managers despedirán primero?

Vota y comenta: ¿Cuál de estos managers despedirán primero?

Vota y comenta: ¿Cuál de estos managers despedirá primero?

Vota y comenta: ¿Por qué Pedro Martínez se pelea con la prensa?

Vota y comenta: Crees que le echaron una brujería a David Ortíz?

Vota y comenta: ¿Qué le recomiendas a Manny Acta?

Vota y comenta: Qué opinas de la posible firma de Pedro con los Yanquis?

Vota y comenta: En cuatro meses y medio: Cuántos jonrones dará Alex Rodríguez?

Vota y comenta: Quién crees que dará más jonrones en el 2009?

Vota y comenta: De estos tres jugadores, quién está más próximo al retiro?

Vota y comenta: ¿Cuál de estos lanzadores te motiva a ver?

Vota y comenta: Qué opinas de la falta de jonrones y remolcadas de Tejada?

Vota y comenta: Cómo calificas el trabajo de Omar Minaya?

Vota y comenta: Cuántos jonrones le proyectas a Nelson Cruz en el 2009?

Vota y comenta: ¿Por cuál de estos peloteros pagarías por verlo jugar?

Vota y comenta: Qué piensas de la actitud de Octavio Dotel frente a Barack Obama?

Vota y comenta: Por qué Pedro Martínez no ha firmado?

Vota y comenta; Qué opinas de los ataques al béisbol de RD?

Vota y comenta: Cuál de estos lentos comienzos de apena más?

Vota y comenta: ¿Es un peloterito Emilio Bonifacio?

Vota y comenta: Cuándo y quién dará alante su primer jonrón?

Vota y comenta: En cuál equipo te gustaría ver a Manny Acta?

Vota y comenta: ¿Qué opinas de que Manny tiene un demonio por dentro?

Vota y comenta: ¿Qué le pasa a David Ortiz?

Vota y comenta: De estos 10 nuevos comentaristas, a quién quieres en Impacto Deportivo?

Vota y comenta: A largo plazo, quién tiene más futuro?

Vota y comenta: Qué opinas de la operación de alex Rodríguez?

Vota y comenta: Quién dará más jonrones en el 2009?

Vota y comenta: Quién es mejor?

Cuál de estos jugadores te dolería más que lo ligaran a los esteroides?

¿Crees que Manny Ramírez usó esteroides?

¿Quién sería tu Más Valioso?

Cómo calificas el abuso de Moisés Alou contra un productor de TV?

Escoge un equipo que pienses que puede ser campeón en el 2009

Cuál de estos jugadores tendrá más presión en el 2009?

Qué le recomiendas a Pedro Martínez?

Quién es mejor lanzador?

Quién es el mejor bateador de la República Dominicana?

Después del pique: Cuál de estos peloteros perdonarías primero?

Cuál sería el salario ideal para Pedro Martínez?

Quién ha sido el mejor Manager de RD en Grandes Ligas?

¿Cómo calificas la vida mujeril de Alex Rodríguez?

De estos lanzadores: Quién llegará más lejos?

¿A quién escuchas con más frecuencia?

¿A quién escuhas más?

¿A quién escuhas más?

Quién ha sido el mejor presidente de la ACD?

Cómo calificas el desprecio de los Cubs a Sammy Sosa?

¿De quién esperas más jonrones en el 2009 en Grandes Ligas?

Con cuál equipo de RD te gustaría ver a Julio Franco como manager?

Con cuál equipo firmará Pedro Martínez?

A qué atribuyes el fracaso de RD en el Clásico?

¿Quién será el mejor pelotero de RD en el Clásico Mundial?

De este grupo: Quién es tu editor deportivo favorito?

En la TV: Con quién te informas en las noches?

En TV; Con quién te informas en las mañanas?

De estos programas de TV: Cuál sigues con más frecuencia?

De estos 10 cronistas de Santiago: A quién sigues con más frecuencia?

De estos 10 jóvenes cronistas: A quién sigues con más frecuencia?

De estos 10 cronistas: ¿A quién sigues con más frecuencia?

De estos dos programas: ¿Cuál prefieres?

De estas tres cronistas: A quién sigues con más frecuencia?

Serie del Caribe: ¿Cuál de estos refuerzos apreciarías más?

Quién te gustaría que fuera el próximo presidente de la Liga de Béisbol?

Y ahora: Quién es el Favorito para ser el Campeón?

Cuál es la Serie Final que quieres?

Luego del colapso: ¿Qué deben hacer las Aguilas?

Luego del colapso: ¿Qué deben hacer las Aguilas?

Luego del colpaso: ¿Qué deben hacer las Aguilas?

Miguel Diloné no cree en peloteros de ahora: Qué opinas?

Ultimo día para acertar: Quién llegó primero en Libro Los 25 Mejores en RD?

Ultimo día para acertar; Quién llegó primero en Libro Los 25 Mejores en RD?

Quién sería el próximo Manager de las Aguilas?

Cuál equipo quieres que represente a RD en la Serie del Caribe?

Hasta el momento: Cuál lanzador te ha encantado más?

Las Aguilas en el sótano con 0-3: Quién tiene la culpa?

Con récord de 0-2: Cómo se siente el fanático de las Aguilas?

La Trilogía Alou: Quién fue mejor en la Pelota de RD?

La Trilogía Alou:Quién fue mejor en la pelota de RD?

¿Dame tu palé de favoritos para pasar a la Serie Final?

Dame tu pronóstico: Quién se queda fuera?

Qué tipo de contrato le darías a Manny Ramírez?

A ver cuál de estos lanzadores irías al estadio?

Finalmente: Con quién firmará Manny Ramírez?

A qué atribuyes la nueva caída de los Leones?

Quién ha sido el Mejor Jugador en la Pelota Invernal de RD?

Quién puede ser el jugador que active al Licey?

Cómo calificas el nombramiento de José Offerman como manager del Licey?

A qué usted atribuye la ligera caída del Licey?

Alex Rodríguez jugará con RD: Cómo te sientes?

Qué tipo de reacción te provoca la noticia de que Alex jugaría con RD?

¿A quién te gustaría como Futuro Manager del Escogido?

Quién se proyecta como el Jugador Más Valioso?

Quién se proyecta como el Manager del Año?

De no ser Licey y Aguilas: Quién te gustaría que gane la corona invernal?

Qué opinas sobre los tantos palos en la Pelota Invernal?

Finalmente: Con cuál equipo firmará Rafael Furcal?

¿Cuál de estos jugadores puede salvar al Escogido?

¿A cuál de estos jugadores te gustaría ver en el Estadio Quisqueya?

A qué atribuyes el dominio de Nelson Figueroa sobre el Licey?

Cuál es tu narrador favorito en la Pelota Invernal de RD?

Cuál de estos jugadores del Licey extrañas más?

A quién prefieres como torpedero de las Aguilas?

A quién prefieres en la tercera base del Licey?

Quién ha sido el mejor pelotero de todos los tiempos en RD?

Qué te ha impactado más este año en la Pelota Invernal?

Por qué la gente no está asistiendo al estadio Quisqueya?

¿Quién es el jugador más popular de la pelota invernal de RD?

Cuando tu equipo pierde: Cómo reaccionas?

Qué es lo que más te gusta del play?

Deben revisarse todos los bates en la pelota de RD?

Cómo calificas la explosión ofensiva en RD?

Si Alberto Castillo saliera de las Aguilas: Dónde te gustaría verlo?

¿A qué atribuyes el gran bateo en pelota de RD?

Productores de más de 50 HR: ¿Quién ha sido el mejor?

¿Quién sería el primer manager cancelado en la pelota de RD?

¿Está en peligro el puesto de Félix Fermín?

Cuál será el equipo campeón de las Grandes Ligas?

Cuál sería la fecha ideal para que comience la pelota de RD?

¿Quién debe retirarse de la Pelota Invernal de RD?

Cuál es tu equipo favorito en el Béisbol Invernal de RD?

Qué le aconsejas a Pedro Martínez?

Da un calificativo a la firma de Omar Minaya

Sin los equipos de NY: Qué equipo apoyarías en los playoffs?

Pedro Martínez acepta ir al bullpen: Qué opinas?

¿Qué le recomiendas a Bartolo Colón?

¿A qué atribuyes que Manny no haya ganado el JMV?

Con la firma de Tony Batista: En qué lugar quedará el Escogido?

Cuál de estos jugadores será el próximo en ser dejado libre por las Aguilas?

Qué Serie Mundial te agradaría más?

Qué Serie Mundial te agradarías más?

Lo mandan al banco: Qué pasará con Robinson Canó?

Si eres fanático del Licey: ¿Quieres que firmen a Tony Batista?

Quién merece ser el Manager del Año de la Liga Nacional?

Sigue el azote: Cómo calificas la labor de Manny con los Dodgers?

¿Qué le recomiendas a Tony Batista?

¿Qué le comiendas a Tony Batista?

Otra vez le molesta la mano: ¿Qué debe hacer David Ortíz?

En los playoffs: A Cuál jugador de RD le pondrás más atención?

No jugarán por fatiga extrema: ¿Cuál de estos jugadores querías ver?

Manny Ramírez juega bien cuando quiere: ¿Qué opinas de eso?

Quién es el mejor pelotero de la actualidad en Grandes Ligas?

¿Quién ha sido Más Valioso en el 2008?

Está en el limbo: Qué pasará con Luis Castillo?

Cuál de estos jugadores te ha decepcionado más en el 2008?

Entre estos jugadores: ¿A quién extrañas más?

¿A qué atribuyes los tantos jonrones contra Pedro Martínez?

Es oficial: Se usarán las repeticiones, ¿Qué opinas?

Con dos outs en el noveno: En quién confías más?

Quién ha sido el mejor bateador de RD en el 2008?

Cuál es el mejor canal para ver la Pelota Invernal de RD?

Quién necesita más jugar Pelota Invernal?

¿Con cuántas victorias terminará Edinson Vólquez?

¿Cuál equipo podría firmar a Pedro Martínez para el 2009?

José Valverde: ¿Cuánto merece ganar en el 2009?

¿Qué piensas de las cábalas de los peloteros de Grandes Ligas?

¿Quién ha sido el mejor pitcher de RD en el 2008?

¿Quién conseguirá mejor contrato en el mercado?

De estos jugadores: Quién no quieres que falte al Clásico Mundial?

¿Cuántos millones por año merece ganar Vladimir Guerrero?

¿Cómo defines el trato de Omar Minaya a Sammy Sosa?

El hombre sigue mal: Qué le aconsejas a David Ortíz?

Dicen que Manny no vale 20 millones: ¿Cuánto le pagarías?

¿Qué te gusta más de esta página Web?

Barry Bonds en la pelota Invernal: ¿Con cuál equipo?

¿Qué le pasó a David Ortíz en el fin de semana?

Dónde ves a Manny Ramírez en el 2009?

Si el cambio de Manny te enfadó: Por cuál equipo simpatizarás?

Cómo calificas la decisión de cambiar a Manny Ramírez?

Quién ha sido el mejor catcher de todos los tiempos?

Quién hace más falta en Boston?

Cómo calificas la labor de José Guillén en Kansas City?

Finalmente, qué pasará con Manny Ramírez?

Quién es mejor en la defensa?

Entre este grupo de Editores Deportivos: Quién es el mejor?

Para enterarte de los Deportes: A cuál de estas Damas sigues?

De este grupo de cronistas deportivos: ¿Quién es el mejor?

Estos dos Bloques dominan la Radio en la noche: Cuál es tu favorito?

En dos Bloques dominan la Radio en la noche: Cuál es tu favorito?

Quién reina en la TV deportiva en las tardes?

Quién reina en la TV deportiva en las mañanas?

Cuál de estos programas deportivos de TV sigues en la noche?

Quién ganó en el cambio?

En caso de que David Ortiz no regrese este año: A quién te gustaría que Boston firme?

Qué es más difícil?

Qué tiene más valor en el béisbol?

Qué le aconsejas a Pedro Martínez?

Del Libro de Mirabal: Quién merecía estar más?

En el Ranking del Libro de Franklin Mirabal: ¿Quién crees que será el número 1?

Del Libro Los 50 Mejores: Quién fue mejor?

Del Libro: Quién tuvo una carrera más relevante?

En Grandes Ligas: ¿Quién fue mejor?

Seguimos con el Libro Los 50 Mejores: Quién fue mejor entre estos lanzadores?

Hablando del libro Los 50 Mejores: ¿Quién fue mejor entre estos jugadores?

¿Cuál ha sido la peor firma de Omar Minaya?

En un equipo de béisbol: ¿Cuál es el jugador más importante?

¿Por ver a cuál de estos jugadores te quedarías en casa?

¿Quién ha tenido una mejor carrera en Grandes Ligas?

¿Aceptas la aclaración de Robinson Canó de quiere jugar en el Clásico Mundial?

¿Ante tantas lesiones, qué usted le recomienda a Moisés Alou?

¿Ante tantas lesiones, qué usted le comienda a Moisés Alou?

David Ortiz juró por la bandera de los Estados Unidos: ¿Qué opinas?

¿Quién lleva mejor carrera para llegar al Salón de la Fama?

Seis peloteros han dado más de 600 jonrones: ¿Quién ha sido el más grande?

¿Crees que Manny Ramírez cambiará de parecer y jugará en el Clásico Mundial?

¿Próximo dominicano con 500 jonrones?

¿A qué atribuyes las tantas lesiones?

¿Quién ha trascendido más en Grandes Ligas?

¿Alguien tiene la explicación de tantas lesiones entre los peloteros de RD?

¿A Quién prefieres como torpedero del Juego de Estrellas?

¿Quién será el mejor lanzador de RD en el 2008?

Sammy Sosa es agente libre en RD: ¿Con cuál equipo te gustaría que jugara?

Los Nacionales están en el sótano: ¿Está en peligro el puesto de Manny Acta?

¿Crees que Manny Ramírez llegará a 600 jonrones?

Crees que Manny Ramírez dará este sábado su jonrón 500: ¿En cuál turno?

Bola de cristal: ¿Qué pasará con Pedro Martínez en el 2009?

¿Cómo calificas la carrera de Sammy Sosa en Grandes Ligas?

¿Quién debe ser el capitán del equipo de RD en el Clásico Mundial?

Imagínate a David Ortiz y Manny Ramírez hoy en el mercado: ¿A quién firmarías?

Imagínate a David Ortiz y Manny Ramírez hoy en el mercado: ¿A quíen firmarías?

¿Quién durará más tiempo como manager en Nueva York?

¿Cómo calificas la negativa de Robinson Canó para no jugar en el Clásico Mundial?

¿En este momento quién es el jugador dominicano más popular?

¿Quién sería el mejor sustituto de Willie Randolph en los Mets?

¿A quién prefieres en el CF para el Clásico Mundial?

¿Quién se perfila como el pitcher del primer día de RD para el Clásico Mundial?

¿Quién debe ser el catcher de RD en el Clásico Mundial?

Los Yanquis están en el sótano: ¿Quién tiene la culpa?

¿Qué opinas sobre la posibilidad de que Felipe Alou vuelva a dirigir en Grandes Ligas?

Estos tres managers están decepcionando: ¿A Quién botarías primero?

Los que más se lesionan: ¿Quién encabeza el equipo de cristal?

¿Qué le recomiendas a Pedro Martínez?

De estos jugadores; ¿Quién te ha impresionado más en el 2008?

¿Cuál equipo podría adquirir a Julián Tavárez?

¿Cuál es el problema de Johnny Cueto?

¿Quién es mejor tercera base?

José Guillén batea .189: ¿Qué tu harías con él?

¿Quién es mejor relevista intermedio en Grandes Ligas?

¿Con cuál gorra te gustaría ver a Manny Ramírez?

Como relevista; ¿En quién confías más?

¿Cuál de las ediciones de Impacto de gusta más?

¿Es Julio Franco un Salón de la Fama?

¿A quién beneficia más el cambio por Willy Mo Peña?

¿Es Juan Marichal el indicado para defender a Miguel Tejada?

Con lo que ha pasado con Johnny Cueto: ¿Lo bajarías a Ligas Menores?

Entre estos jugadores: ¿Cuál es más vago en su profesión?

Entre estos tres jugadores: ¿Quién te ha impresionado más?

De estos 10 Futuros Comentaristas: ¿Quién crees que llegará más lejos?

último juego: David Ortíz de 6-0: ¿Hay alguna preocupación?

¿Cuál de estos jugadores ha tenido la labor más decepcionante?

¿Cuál de estos jugadores extrañas más en Grandes Ligas?

Cuando sea agente libre: ¿Dónde te gustaría ver a Hanley Ramírez?

Después del insulto de Hank Steinbrenner: ¿Crees que Joe Girardi debería renunciar?

¿A qué atribuyes las tantas lesiones en Grandes Ligas?

¿Cree usted que Miguel Tejada metió la pata?

Tejada en su peor momento: ¿Apoya usted que los peloteros de RD se quiten la edad?

Miguel Tejada ahora es más viejo: ¿Cómo calificas eso?

¿Cuál de estas firmas usted le cuestionaría a Omar Minaya?

Cuando Pedro Martínez se retire: ¿Cuál de estos capítulos recordarás más?

Entre estos dirigentes: ¿Quién está en la cuerda floja?

A tu juicio: ¿Cuál es el problema de David Ortiz?

¿Quién ha sido el pelotero de RD más grande en las Grandes Ligas?

De estos futuros agentes libres: ¿Quién conseguirá más dinero?

Si estos tres jugadores estuvieran en el mercado hoy: ¿A quién escogerías primero?

Especulan que la lesión de Pedro Martínez es más complicada: ¿Para cuándo lo esperas?

¿Quién crees que puede llegar a ser mejor?

¿Apoya usted que Ozzie Guillén le dé boches a sus jugadores?

David batea .111 y Manny .200 ¿Eso te preocupa?

De aquí a tres años: ¿Quién será mejor jugador?

Pedro Martínez: ¿Llegó el tiempo del retiro?

¿Cuál de estos jugadores Felipe Alou puede convencer más rápido para jugar en el Clásico Mundial?

Pedro Martínez debuta este martes contra los Marlins: ¿Qué le pronosticas?

¿Cree usted que Manny Acta aplica el compadreo con algunos jugadores de RD?

¿Cuál manager estará en la silla caliente en el 2008?

¿En cuál turno al bate te gustaría ver a Hanley Ramírez?

¿Cuál de estos peloteros es más hipócrita?

Hablemos con la verdad: ¿Usted cree que Alex Rodríguez ha usado esteroides?

¿Fue correcta la decisión de pasar a David para tirarle a Manny Ramírez?

Nada nuevo sobre Sammy Sosa: ¿Que le recomiendas?

¿Cuántos juegos ganará Odalís Pérez en el 2008?

¿Cómo ves a los Yanquis de Nueva York para el 2008?

En el Clásico Mundial: ¿A quién prefieres en la tercera base?

En el Clásico Mundial; ¿Quién sería el torpedero?

En el Clásico Mundial: ¿A quién prefieres en la seguna base?

En el Clásico Mundial: ¿Quién sería el cerrador?

Con lo dicho por Felipe Alou: ¿Deben nombrarlo de inmediato?

¿Quién será el jugador de RD que dará más jonrones en el 2008?

¿Quién podría ser el Manager del Año de la Liga Nacional en el 2008?

¿Quién podría ser el Más Valioso de la Liga Americana en el 2008?

Si vas a construir un equipo hoy: ¿A quién eliges primero entre estos jugadores?

Ya que se definieron los candidatos para ser manager de RD en el Clásico Mundial: ¿Cuál es tu favorito?

Ya que se definieron los candidados para ser manager de RD en el Clásico Mundial: ¿Cuál es tu favorito?

¿A qué atribuyes que Sammy Sosa no tenga trabajo?

Dale vuelta a tu bola de cristal: ¿Cuántos juegos ganará Pedro Martínez en el 2008?

Parece que quieren destruir el béisbol con el caso de los esteroides: ¿Qué tú prefieres?

Entre estos lanzadores: ¿Quién crees que ganará más juegos en el 2008?

¿Qué palé es el favorito para llegar a la Serie Mundial?

¿A qué atribuyes la aparición de tantas lesiones entre los jugadores?

Parece que nadie firmará a Sammy Sosa: ¿Crees que exista un complot en su contra?

Parece que nadie firmará a Sammy Sosa: ¿Crees que haya un complot en su contra?

En este momento: ¿Quién es el mejor intermedista de RD en GL?

¿Cuál es el equipo favorito en la división central de la Liga Nacional?

RD exige una sede en el Clásico Mundial: ¿Prosperará ese pedido?

Sin apasionamientos: ¿Quién es mejor Gerente General en Grandes Ligas?

Si fueras a construir un equipo para ganar en el 2008: ¿A quién escogerías primero?

¿Quién hace menos daño defensivamente en los jardines?

En cuestión de horas, Sammy Sosa firmará para regresar a GL: ¿Dónde lo quieres ver?

¿Cómo calificas el desaire de Manny Ramírez al Presidente George W Bush?

Mueve tu bola de cristal: ¿Qué ves en el futuro de Pedro Martínez para el 2009?

Entre los lanzadores dominicanos: ¿Quién ganará más juegos en el 2008?

Al acercarse la temporada de Grandes Ligas: ¿A quién preferirías en el siore de un equipo tuyo?

¿Con quién te informas, en TV, en las mañanas?

Entre estos apreciados colegas: ¿Quién es el mejor cronista deportivo?

De este grupo de cronistas deportivos: ¿Quién te agrada más?

¿Qué programa deportivo de TV sigues en la noche durante la semana?

Con lo declarado por Pedro sobre Johan Santana: ¿Fue sincero?

Faltan 8 días para los entrenamientos de Grandes Ligas: ¿Quién conseguirá trabajo primero?

¿Qué pareja de jugadores darías para adquirir a Nelson Cruz?

¿Quién ha sido el Más Valioso del Licey en la Serie del Caribe?

Campeón Nacional o del Caribe: ¿Qué tiene más importancia?

Si tuvieras que dar una puntuación: ¿Cómo calificarías la Serie del Caribe?

Juego Tigres vs Aguilas en Santiago: ¿Por qué no se llenó el estadio?

¿Qué te ha impresionado más de la Serie del Caribe Santiago 2008?

Manny Ramírez: ¿Todavía es un jugador de 20 millones de dólares anuales?

Aguilas y Tigres chocan hoy otra vez: ¿Puedes adivinar el score final?

Omar Minaya declina opinar: ¿Quién debe abrir el primer juego de los Mets?

Como van las cosas: ¿Crees que se repetirá la batalla final entre Tigres y Aguilas?

La Ceremonia Inaugural de la Serie del Caribe: ¿Cómo la calificas?

De ser campeones, Aguilas o Licey: ¿Cuál sería su récord en la Serie del Caribe?

¿Cómo calificas la decisión de Kendry Morales de ignorar a la República Dominicana?

¿Cómo piensas seguir la Serie del Caribe?

TJ Peña o Miguel Tejada: ¿A quién prefieres en el siore de las Aguilas?

Omar Minaya se luce al adquirir a Johan Santana: ¿Ahora los Mets pueden ser campeones?

¿Qué palo ha sido más memorable en la pelota invernal de RD?

La gente del Escogido, Estrellas, Toros y Gigantes: ¿Con quién están en la Serie del Caribe?

¿Quién será el refuerzo más codiciado para la Serie del Caribe?

Aguilas campeones: ¿Quién fue el Más Valioso de la Serie Final?

Tema de debate: ¿Miguel Tejada debió tocar en el séptimo juego de la Serie Final?

Triunfo del Licey: ¿Crees que la Serie Final llegará a los 9 juegos?

Las Aguilas Cibaeñas ganaron y pusieron la Serie Final 4-2: ¿Se coronarán este jueves?

Las Aguilas ganaron y pusieron la Final 4-2: ¿Se coronan este jueves?

¿Debe Chilote Llenas pintar de Azul una parte del estadio Cibao para la Serie del Caribe?

¿Cree usted que Tim Tolman era el Fucú de los Tigres del Licey?

Carlos Peña no jugará con el Licey: ¿Quedas satisfecho con su explicación?

Bartolo Colón vs Ervin Santana este lunes: ¿Quién lanzará mejor?

Sammy Sosa le dice adiós a Texas: ¿Qué debe hacer ahora?

El Licey cae 0-3 en la Serie Final: ¿Crees que se puede producir una barrida?

El Licey cae 0-2 en la Serie Final: ¿Crees que se puede producir una barrida?

¿Quién ganará la Serie Final y en cuántos partidos?

¿Cómo calificas el equipo del Licey que acaba de clasificar a la Serie Final?

José Guillén se va para Kansas City: ¿Qué tanto puede eso afectar al Licey?

Parece que todo está definido: ¿Quién será el campeón?

Se apagó la magia de las Estrellas: ¿Crees que todavía pueden llegar a la Serie Final?

¿Cuál de estos jugadores podría ser la pieza inspiradora para los Tigres del Licey?

Atención Liceístas: ¿Debe Tim Tolman mandar al banco a José Bautista?

Aguilas y Tigres están cercando a las Estrellas Orientales: ¿Aguantarán la presión?

¿Quién es el mejor manager de la pelota invernal de RD?

¿A quién le convino la suspensión del juego del estadio Cibao?

Otra derrota de los Gigantes del Cibao: ¿Crees que todavía pueden llegar a la Serie Final?

¿En cuál de estos estadios aparecen más fanáticos imprudentes?

Si no eres Estrellista, y los Orientales ganan la corona: ¿Qué pensarías?

Tim Tolman es el manager del Licey: ¿Cómo calificas su trabajo?

Si eres Aguilucho, y las Aguilas pierden: ¿Irías a ver los juegos de la Serie del Caribe?

Las Estrellas se despegan: ¿Crees que se cayó la posible Final Aguilas-Licey?

¿A qué atribuyes la caída de los Gigantes del Cibao?

Si Luis Polonia se va de las Aguilas: ¿En cuál equipo encajaría mejor?

Las Estrellas se quedaron en el primer lugar: ¿De seguir así, quién sería el segundo equipo que iría a la Serie Final?

Juego empate en el noveno y hombre en segunda: ¿En quién confías más?

¿Crees que exista algún plan para destruir los torneos de béisbol invernal?

¿Cree usted que Tony Peña tuviera que ver con la prohibición de jugar en contra de Robinson Canó?

¿Cómo calificas el servicio de la venta de boletas en los estadios del país?

¿Creen ustedes en la famosa gripe de Ramón Ortíz y José Guillén?

Sin Robinson Canó y Vincent Sinisi: ¿Cree usted que las Estrellas Orientales pueden llegar a la Serie Final?

Luis Polonia no ha brillado este año: ¿Es su liderazgo lo que le hace falta a las Aguilas?

¿Cuál de estos jugadores piensas que puede ser la sensación del Todos contra Todos?

Todo está definido: ¿Cuál es tu palé de equipos para la Serie Final?

Si te pidieran elegir un equipo que seguro va para la Serie Final: ¿Cuál sería?

En caso de que los Leones no clasifiquen: ¿Deben regresar Mario Soto y Bienvenido Figueroa?

¿Cuál pareja de equipos pronosticas que llegará a la Serie Final?

Si eres fanático de las Aguilas: ¿Cómo te sientes en este momento?

¿Cree usted que desde Santiago hay celos hacia los Gigantes del Cibao?

¿Cuál equipo te gustaría que clasifique en el cuarto lugar?

¿Qué opinas del desplante de Wily Mo Peña hacia el Escogido?

Se teme por otro fracaso del Escogido: ¿Qué le aconseja a Julio Hazim?

Miguel Tejada no aparece: ¿Crees que realmente usó esteroides?

Si eres Escogidista y eliminan a tu equipo: ¿A cuál conjunto apoyarías?

La mayor sorpresa ha sido con Roger Clemens: ¿Cuál es tu posición?

Después del reporte de George Mitchell sobre los esteroides: ¿Cuál es tu opinión?

Después de las declaraciones de Julio Hazim: ¿Qué usted le recomienda a Mario Soto?

Después de las declaraciones de Julio Hazim: ¿Qué usted le recomienda a Mario Soto?

Sin importar cual sea tu equipo: ¿Por cuál de estos jugadores comprarías una boleta para ir al play?

¿Cómo calificas las declaraciones del doctor Julio Hazim?

Aunque el Licey ha estado bien, hay mucha gente que no le gusta Tim Tolman: ¿Cómo lo calificas como manager?

¿Crees que el Escogido tiene tiempo de levantarse y clasificar?

En breve se sabrá quien dirigirá el Escogido: ¿Cuál es tu candidato?

¿Cómo calificas el trabajo de Mario Soto como gerente general del Escogido?

Tony Batista declara guerra a fanáticos Aguilas: ¿Que ustedes harían con él?

El Escogido botó al dirigente Mako Oliveras: ¿Quién será el próximo?

¿Quién es el mejor gerente general de la pelota invernal de RD?

Se acerca el cambio de Miguel Tejada: ¿En cuál equipo lo ves?

Soplan nuevos vientos en el Escogido: ¿Cómo tu lo sientes?

¿Crees que Omar Minaya le dará permiso a Pedro Martínez para tire con el Licey?

Félix Fermín se queja de los árbitros: ¿Qué calificación le das a los umpires?

Es innegable, las Aguilas están mal: ¿Qué se debe hacer?

Dicen algunos comentaristas que los árbitros favorecen al Licey: ¿Cómo calificas eso?

De las páginas Web de los equipos de la pelota de RD: ¿Cuál es tu preferida?

Neifi Pérez acudió al estadio Quisqueya y no descarta jugar con el Escogido. ¿Te gustaría que juegue este año?

Con Odalís, Dotel y Olivo: ¿Qué tan lejos puede llegar el Escogido?

Si todo terminara hoy: ¿Quién sería el Jugador Más Valioso?

Se abre el debate: ¿Cada pelotero debe jugar en el equipo de su pueblo?

Las Aguilas perdieron los tres juegos del fin de semana: ¿Cuál es el problema?

¿Cómo calificas la suspensión de cinco partidos al dirigente de las Estrellas Arturo DeFreites?

¿Cuántos millones le darías a Carlos Peña por cuatro años?

¿Qué haces cuando tu equipo pierde en la pelota invernal de RD?

En menos de 24 horas se decide el cambio de Furcal por Wily Mo: ¿Tú haces el negocio?

De los jugadores activos de las Aguilas: ¿Quién podría ser el sustituto de Félix Fermín?

¿Qué está pasando con el dominicano Miguel Tejada?

En el lío del juego de San Pedro: ¿Quién tiene más culpa?

¿Qué opinas con relación a que los dueños y gerentes se sienten al lado del manager?

Cuentame de la música que ponen en el play: ¿Cuál es el género que más te gusta?

¿Cómo calificas los pedidos de cambio de los jugadores en la pelota de RD?

¿Por qué la gente va menos a los estadios de béisbol?

¿A cuál de estos jugadores deseas ver pronto en la pelota de RD?

Con cinco derrotas corridas: ¿Está en peligro el puesto de Félix Fermín?

Si clasificamos a Licey, Aguilas y Gigantes: ¿Quién llegaría en cuarto lugar?

¿Cuál de estos factores podría estar afectando a las Aguilas?

¿Cuál de estos factores podría estar afectado a las Aguilas?

¿Es correcta la decisión de Omar Minaya de salir de sus prospectos por lanzadores?

Si todo terminara hoy: ¿Quién sería el Manager del Año?

¿Quién debería ser el capitán de los Leones del Escogido?

¿Qué piensas de este tranque que se le presenta a Alex Rodríguez?

¿Si fueras gerente, cambiarías a Furcal por Víctor Díaz?

¿Cuánto merecería ganar Sammy Sosa en el 2008?

¿Cómo calificas las opiniones del Yahoo sobre los agentes libres de RD?

¿Cómo calificas las opiniones de CNN sobre los agentes libres de RD?

¿Quién ganará hoy el Cy Young de la Liga Americana?

El Escogido está en el sótano: ¿Deben botar al dirigente Donnie Scott?

Carlos Gómez no impacta con el Escogido: ¿A tu juicio qué le pasa?

José Lima es un show en el montículo: ¿Cómo calificas sus gestos?

José Valverde no tirará con los Toros: ¿En cuál equipo te gustaría verlo?

A raíz del lío de Tony Batista: ¿Cuál debería ser el salario tope mensual en RD?

Pedro Martínez dice que talvez lance con el Licey. ¿Cuándo lo haría?

¿Qué le recomendarías a Miguel Tejada para el 2008?

¿Cómo calificas el aporte de los peloteros a los afectados de la tormenta Noel?

¿Cuál de estos jugadores conseguirá trabajo primero?

¿Cuál de estos jugadores será más decisivo para las Aguilas?

¿Cuál de estos jugadores será más decisivo para el Licey?

¿Piensas asistir a la Serie del Caribe que se jugará en Santiago?

¿En cuál equipo ves a Alex Rodríguez para el 2008?

¿Cuál equipo evitaría una futura final entre Aguilas y Licey?

Cuando vas a los estadios en la Pelota. ¿Cuáles de las bailarinas?

Quién ha sido el mejor jugador de todos los tiempos en la pelota invernal de RD?

En la Pelota Invernal de RD, cuál es la Cadena de Transmisión que más te emociona?

¿Quién ha sido el mejor jugador de todos los tiempos en las Grandes Ligas?

¿En cuál estadio de la República Dominicana se disfruta más?

¿Cuál es el equipo de Grandes Ligas más popular en la República Dominicana?

¿Quien ha sido más grande en el Béisbol Invernal?

¿Quién ha sido el mejor lanzador de República Dominicana en las Grandes Ligas?

¿Crees que los Yanquis desplazarán a Boston en el Este de la Americana?

¿Cuál es tu equipo favorito en la República Dominicana?

Noveno episodio, bases llenas y dos outs. ¿A quién traes a batear?

    Comunícate con Nosotros
  © Copyright 2007-2009, Impacto Deportivo, Santo Domingo, República Dominicana. Todos los derechos reservados. Diseño y Hosting: Solunion Group